Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AFAP1 cdna clone

AFAP1 cDNA Clone

Gene Names
AFAP1; AFAP; AFAP110; AFAP-110
Synonyms
AFAP1; AFAP1 cDNA Clone; AFAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagagttaatagttgaacttcgtctctttcttgaactcctggaccatgaatatctaacctcaactgtcagggagaaaaaggcagtgataaccaacattctgctaagaatacagtcatccaaaggttttgatgtgaaggaccatgctcagaagcaggagaccgctaacagcctgccagcccctcctcagatgcccctgccggagatccctcagccctggctgcctcctgacagtgggcctccaccattgccaacatcctccctcccagaaggttattatgaggaagctgtgccactgagccccggaaaagctccggaatacatcacatcaaattatgattccgatgcgatgagcagctcttatgagtcgtatgatgaagaggaggaggatgggaaggggaagaaaacccggcaccagtggccctccgaggaggcctccatggacctggtcaaggacgccaaaatctgcgccttcctgctgcggaagaagcggttcggccagtggaccaagttgctctgcgtcatcaaagacaccaaactgctgtgctataaaagttccaaggaccagcagcctcagatggaactgccactccaaggctgtaacattacgtacatcccgaaagacagcaaaaagaagaagcacgagctgaagattactcagcagggcacggacccgcttgttctcgccgtccagagcaaggaacaggccgagcagtggctgaaggtgatcaaagaagcctacagtggttgtagtggccccgtggattcagagtgtcctcctccaccaagctccccggtgcacaaggcagaactggagaagaaactgtcttcagagagacccagctcagatggggagggtgttgtggaaaatggaattaccacatgtaatggaaaggagcaagtgaagaggaagaaaagttccaaatcagaggccaagggcactgtgtcgaaagtcactgggaaaaaaatcaccaagatcatcagtctgggaaagaaaaagccgtccacagacgagcagacctcctcagctgaggaagatgttcccacctgcggctatctgaacgtgctctccaacagccgctggcgagagcgctggtgccgagtgaaagataacaagctcattttccacaaggacaggaccgacctgaagacccatattgtgtctattccgctccgtggctgcgaggtgatcccgggtttggattgtaaacatcctctgacgttccggctgctgcgcaacggccaggaggttgcagtattggaggcatcttcttctgaagacatgggcaggtggattgggattttactcgcagagacgggatcgtccacagacccggaggctctgcactatgactacattgatgtggagatgtctgcaagtgtcattcagacagccaaacagaccttctgtttcatgaacaggcgtgttatatctgctaacccatatctagggggcacctccaacggctatgcccaccccagcgggacggcacttcattatgacgatgtcccgtgcatcaacggctcgctcaagggtaaaaagccccccgtggcgtctaatggggtcacaggaaaagggaagactctgagcagtcagccaaagaaagcggatcccgcggctgttgtgaaaaggacgggttcgaatgctgcccagtacaagtatggcaagaaccgggtagaagcagatgccaagcggctacagaccaaagaggaggagctgctgaagaggaaagaggccctgcggaataggctggcccagctccgcaaggaaagaaaagaccttcgagcggctattgaagtgaacgccggcaggaagccgcaggcgatcctggaggagaagctgaagcagctggaggaggagtgccggcagaaggaggcggagcgtgtcagcctggagctggagctgacggaggtcaaggagagcctgaagaaagcgctggcgggcggagtcaccctggggctggccatcgagcccaagtcagggacatcgagtccacagtctccagtgttccggcaccggaccctggaaaactcgcccatctccagctgtgacaccagtgacaccgagggccccgtgccggtgaacagcgcggccgtcttgaagaagagccaggctgccccgggcagctccccctgccgagggcatgtgctgcggaaggccaaggaatgggaattgaagaacgggacctag
Sequence Length
2193
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,795 Da
NCBI Official Full Name
Homo sapiens actin filament associated protein 1, mRNA
NCBI Official Synonym Full Names
actin filament associated protein 1
NCBI Official Symbol
AFAP1
NCBI Official Synonym Symbols
AFAP; AFAP110; AFAP-110
NCBI Protein Information
actin filament-associated protein 1
UniProt Protein Name
Actin filament-associated protein 1
UniProt Gene Name
AFAP1
UniProt Synonym Gene Names
AFAP; AFAP-110
UniProt Entry Name
AFAP1_HUMAN

NCBI Description

The protein encoded by this gene is a Src binding partner. It may represent a potential modulator of actin filament integrity in response to cellular signals, and may function as an adaptor protein by linking Src family members and/or other signaling proteins to actin filaments. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Uniprot Description

AFAP: Can cross-link actin filaments into both network and bundle structures. May modulate changes in actin filament integrity and induce lamellipodia formation. May function as an adapter molecule that links other proteins, such as SRC and PKC to the actin cytoskeleton. Seems to play a role in the development and progression of prostate adenocarcinoma by regulating cell-matrix adhesions and migration in the cancer cells.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 4p16

Cellular Component: focal adhesion

Research Articles on AFAP1

Similar Products

Product Notes

The AFAP1 afap1 (Catalog #AAA1278170) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagagt taatagttga acttcgtctc tttcttgaac tcctggacca tgaatatcta acctcaactg tcagggagaa aaaggcagtg ataaccaaca ttctgctaag aatacagtca tccaaaggtt ttgatgtgaa ggaccatgct cagaagcagg agaccgctaa cagcctgcca gcccctcctc agatgcccct gccggagatc cctcagccct ggctgcctcc tgacagtggg cctccaccat tgccaacatc ctccctccca gaaggttatt atgaggaagc tgtgccactg agccccggaa aagctccgga atacatcaca tcaaattatg attccgatgc gatgagcagc tcttatgagt cgtatgatga agaggaggag gatgggaagg ggaagaaaac ccggcaccag tggccctccg aggaggcctc catggacctg gtcaaggacg ccaaaatctg cgccttcctg ctgcggaaga agcggttcgg ccagtggacc aagttgctct gcgtcatcaa agacaccaaa ctgctgtgct ataaaagttc caaggaccag cagcctcaga tggaactgcc actccaaggc tgtaacatta cgtacatccc gaaagacagc aaaaagaaga agcacgagct gaagattact cagcagggca cggacccgct tgttctcgcc gtccagagca aggaacaggc cgagcagtgg ctgaaggtga tcaaagaagc ctacagtggt tgtagtggcc ccgtggattc agagtgtcct cctccaccaa gctccccggt gcacaaggca gaactggaga agaaactgtc ttcagagaga cccagctcag atggggaggg tgttgtggaa aatggaatta ccacatgtaa tggaaaggag caagtgaaga ggaagaaaag ttccaaatca gaggccaagg gcactgtgtc gaaagtcact gggaaaaaaa tcaccaagat catcagtctg ggaaagaaaa agccgtccac agacgagcag acctcctcag ctgaggaaga tgttcccacc tgcggctatc tgaacgtgct ctccaacagc cgctggcgag agcgctggtg ccgagtgaaa gataacaagc tcattttcca caaggacagg accgacctga agacccatat tgtgtctatt ccgctccgtg gctgcgaggt gatcccgggt ttggattgta aacatcctct gacgttccgg ctgctgcgca acggccagga ggttgcagta ttggaggcat cttcttctga agacatgggc aggtggattg ggattttact cgcagagacg ggatcgtcca cagacccgga ggctctgcac tatgactaca ttgatgtgga gatgtctgca agtgtcattc agacagccaa acagaccttc tgtttcatga acaggcgtgt tatatctgct aacccatatc tagggggcac ctccaacggc tatgcccacc ccagcgggac ggcacttcat tatgacgatg tcccgtgcat caacggctcg ctcaagggta aaaagccccc cgtggcgtct aatggggtca caggaaaagg gaagactctg agcagtcagc caaagaaagc ggatcccgcg gctgttgtga aaaggacggg ttcgaatgct gcccagtaca agtatggcaa gaaccgggta gaagcagatg ccaagcggct acagaccaaa gaggaggagc tgctgaagag gaaagaggcc ctgcggaata ggctggccca gctccgcaag gaaagaaaag accttcgagc ggctattgaa gtgaacgccg gcaggaagcc gcaggcgatc ctggaggaga agctgaagca gctggaggag gagtgccggc agaaggaggc ggagcgtgtc agcctggagc tggagctgac ggaggtcaag gagagcctga agaaagcgct ggcgggcgga gtcaccctgg ggctggccat cgagcccaag tcagggacat cgagtccaca gtctccagtg ttccggcacc ggaccctgga aaactcgccc atctccagct gtgacaccag tgacaccgag ggccccgtgc cggtgaacag cgcggccgtc ttgaagaaga gccaggctgc cccgggcagc tccccctgcc gagggcatgt gctgcggaag gccaaggaat gggaattgaa gaacgggacc tag. It is sometimes possible for the material contained within the vial of "AFAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.