Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BTF3 cdna clone

BTF3 cDNA Clone

Gene Names
BTF3; NACB; BTF3a; BTF3b; BETA-NAC
Synonyms
BTF3; BTF3 cDNA Clone; BTF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagaaacaatcatgaaccaggaaaaactcgccaaactgcaggcacaagtgcgcattggtgggaaaggaactgctcgcagaaagaagaaggtggttcatagaacagccacagcagatgacaaaaaacttcagttctccttaaagaagttaggggtaaacaatatctctggtattgaagaggtgaatatgtttacaaaccaaggaacagtgatccactttaacaaccctaaagttcaggcatctctggcagcgaacactttcaccattacaggccatgctgagacaaagcagctgacagaaatgctacccagcatcttaaaccagcttggtgcggatagtctgactagtttaaggagactggccgaagctctgcccaaacaatctgtggatggaaaagcaccacttgctactggagaggatgatgatgatgaagttccagatcttgtggagaattttgatgaggcttccaagaatgaggcaaactga
Sequence Length
489
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
689
Molecular Weight
17,699 Da
NCBI Official Full Name
Homo sapiens basic transcription factor 3, mRNA
NCBI Official Synonym Full Names
basic transcription factor 3
NCBI Official Symbol
BTF3
NCBI Official Synonym Symbols
NACB; BTF3a; BTF3b; BETA-NAC
NCBI Protein Information
transcription factor BTF3
UniProt Protein Name
Transcription factor BTF3
UniProt Gene Name
BTF3
UniProt Synonym Gene Names
NACB; NAC-beta
UniProt Entry Name
BTF3_HUMAN

NCBI Description

This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]

Uniprot Description

BTF3: a general transcription factor. BTF3 can form a stable complex with RNA polymerase II. An interaction partner of protein kinase CK2. Required for the initiation of transcription. Expressed at high levels in glioblastoma multiforme. Overexpressed in the microsatellite instability (MIN) phenotypes in colorectal cancer. Up-regulated strongly in the mammary gland during pregnancy, suggesting an involvement in alveolar growth. Two alternatively spliced isoforms have been described.

Protein type: Transcription initiation complex; Transcription factor

Chromosomal Location of Human Ortholog: 5q13.2

Molecular Function: protein binding

Biological Process: transcription from RNA polymerase II promoter

Research Articles on BTF3

Similar Products

Product Notes

The BTF3 btf3 (Catalog #AAA1278165) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagaaa caatcatgaa ccaggaaaaa ctcgccaaac tgcaggcaca agtgcgcatt ggtgggaaag gaactgctcg cagaaagaag aaggtggttc atagaacagc cacagcagat gacaaaaaac ttcagttctc cttaaagaag ttaggggtaa acaatatctc tggtattgaa gaggtgaata tgtttacaaa ccaaggaaca gtgatccact ttaacaaccc taaagttcag gcatctctgg cagcgaacac tttcaccatt acaggccatg ctgagacaaa gcagctgaca gaaatgctac ccagcatctt aaaccagctt ggtgcggata gtctgactag tttaaggaga ctggccgaag ctctgcccaa acaatctgtg gatggaaaag caccacttgc tactggagag gatgatgatg atgaagttcc agatcttgtg gagaattttg atgaggcttc caagaatgag gcaaactga. It is sometimes possible for the material contained within the vial of "BTF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.