Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP2M1 cdna clone

AP2M1 cDNA Clone

Gene Names
AP2M1; mu2; AP50; CLAPM1
Synonyms
AP2M1; AP2M1 cDNA Clone; AP2M1 cdna clone
Ordering
For Research Use Only!
Sequence
atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgttaagcggtccaacatttggctggcagcagtcaccaagcagaatgtcaacgctgccatggtcttcgaattcctctataagatgtgtgacgtgatggctgcctactttggcaagatcagcgaggaaaacatcaagaacaattttgtgctcatatatgagctgctggatgagattctagactttggctacccacagaattccgagacaggcgcgctgaaaaccttcatcacgcagcagggcatcaagagtcagacaaaagaagagcagtcacagatcaccagccaggtaactgggcagattggctggcggcgagagggtatcaagtatcgtcggaatgagctcttcctggatgtgctggagagtgtgaacctgctcatgtccccacaagggcaggtgctgagtgcccatgtgtcgggccgggtggtgatgaagagctacctgagtggcatgcctgaatgcaagtttgggatgaatgacaagattgttattgaaaagcagggcaaaggcacagctgatgaaacaagcaagagcgggaagcaatcaattgccattgatgactgcaccttccaccagtgtgtgcgactcagcaagtttgactctgaacgcagcatcagctttatcccgccagatggagagtttgagcttatgaggtatcgcacaaccaaggacatcatccttcccttccgggtgatcccgctagtgcgagaagtgggacgcaccaaactggaggtcaaggtggtcatcaagtccaactttaaaccctcactgctggctcagaagattgaggtgaggatcccaaccccactgaacacaagcggggtgcaggtgatctgcatgaaggggaaggccaagtacaaggccagcgagaatgccatcgtgtggaagatcaagcgcatggcaggcatgaaggaatcgcagatcagcgcagagattgagcttctgcctaccaacgacaagaagaaatgggctcgaccccccatttccatgaactttgaggtgccattcgcaccctctggcctcaaggtgcgctacttgaaggtgtttgaaccgaagctgaactacagcgaccatgatgtcatcaaatgggtgcgctacattggccgcagtggcatttatgaaactcgctgctag
Sequence Length
1302
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,389 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 2, mu 1 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 2 mu 1 subunit
NCBI Official Symbol
AP2M1
NCBI Official Synonym Symbols
mu2; AP50; CLAPM1
NCBI Protein Information
AP-2 complex subunit mu
UniProt Protein Name
AP-2 complex subunit mu
UniProt Gene Name
AP2M1
UniProt Synonym Gene Names
CLAPM1; KIAA0109
UniProt Entry Name
AP2M1_HUMAN

NCBI Description

This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

Uniprot Description

AP2M1: a protein of the adaptor complexes medium subunit family. A subunit of the heterotetrameric coat assembly protein complex 2 (AP2) which links clathrin to receptors in coated vesicles. Interacts with the cytoplasmic tails of membrane proteins and polyphosphoinositide-containing lipids. Is not required for clathrin-coated vesicle formation at the plasma membrane, but that it is one of several endocytic adaptors required for the uptake of certain cargo proteins. Is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. AP-2 is a heterotetramer composed of two large chains (alpha and beta), a medium chain (AP50) and a small chain (AP17).

Protein type: Vesicle; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: AP-2 adaptor complex; cytosol; lysosomal membrane; plasma membrane

Molecular Function: low-density lipoprotein receptor binding; protein binding; signal sequence binding; transporter activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; ephrin receptor signaling pathway; microtubule-based movement; negative regulation of epidermal growth factor receptor signaling pathway; regulation of defense response to virus by virus; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on AP2M1

Similar Products

Product Notes

The AP2M1 ap2m1 (Catalog #AAA1278146) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattggag gcttattcat ctataatcac aagggggagg tgctcatctc ccgagtctac cgagatgaca tcgggaggaa cgcagtggat gcctttcggg tcaatgttat ccatgcccgg cagcaggtgc gcagccccgt caccaacatt gctcgcacca gcttcttcca cgttaagcgg tccaacattt ggctggcagc agtcaccaag cagaatgtca acgctgccat ggtcttcgaa ttcctctata agatgtgtga cgtgatggct gcctactttg gcaagatcag cgaggaaaac atcaagaaca attttgtgct catatatgag ctgctggatg agattctaga ctttggctac ccacagaatt ccgagacagg cgcgctgaaa accttcatca cgcagcaggg catcaagagt cagacaaaag aagagcagtc acagatcacc agccaggtaa ctgggcagat tggctggcgg cgagagggta tcaagtatcg tcggaatgag ctcttcctgg atgtgctgga gagtgtgaac ctgctcatgt ccccacaagg gcaggtgctg agtgcccatg tgtcgggccg ggtggtgatg aagagctacc tgagtggcat gcctgaatgc aagtttggga tgaatgacaa gattgttatt gaaaagcagg gcaaaggcac agctgatgaa acaagcaaga gcgggaagca atcaattgcc attgatgact gcaccttcca ccagtgtgtg cgactcagca agtttgactc tgaacgcagc atcagcttta tcccgccaga tggagagttt gagcttatga ggtatcgcac aaccaaggac atcatccttc ccttccgggt gatcccgcta gtgcgagaag tgggacgcac caaactggag gtcaaggtgg tcatcaagtc caactttaaa ccctcactgc tggctcagaa gattgaggtg aggatcccaa ccccactgaa cacaagcggg gtgcaggtga tctgcatgaa ggggaaggcc aagtacaagg ccagcgagaa tgccatcgtg tggaagatca agcgcatggc aggcatgaag gaatcgcaga tcagcgcaga gattgagctt ctgcctacca acgacaagaa gaaatgggct cgacccccca tttccatgaa ctttgaggtg ccattcgcac cctctggcct caaggtgcgc tacttgaagg tgtttgaacc gaagctgaac tacagcgacc atgatgtcat caaatgggtg cgctacattg gccgcagtgg catttatgaa actcgctgct ag. It is sometimes possible for the material contained within the vial of "AP2M1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.