RCN2 cdna clone
RCN2 cDNA Clone
Gene Names
RCN2; E6BP; ERC55; ERC-55; TCBP49
Synonyms
RCN2; RCN2 cDNA Clone; RCN2 cdna clone
Sequence
atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggccacgaagagcagcaaaaaagactgcaggcgatcataaagaaaatcgacttggactcagatggctttctcactgaaagtgaactcagttcatggattcagatgtcttttaagcattatgctatgcaagaagcaaaacaacagtttgttgaatatgataaaaacagtgatgatactgtgacttgggatgaatataacattcagatgtatgatcgtgtgattgactttgatgagaacactgctctggatgatgcagaagaggagtcctttaggaagcttcacttaaaggacaagaagcgatttgaaaaagctaaccaggattcaggtcccggtttgagtcttgaagaatttattgcttttgagcatcctgaagaagttgattatatgacggaatttgtcattcaagaagctttagaagaacatgacaaaaatggtgatggatttgttagtttggaagaatttcttggtgattacaggtgggatccaactgcaaatgaagatccagaatggatacttgttgagaaagacagattcgtgaatgattatgacaaagataacgatggcaggcttgatccccaagagctgttaccttgggtagtacctaataatcagggcattgcacaagaggaggcacttcatctaattgatgaaatggatttgaatggtgacaaaaagctctctgaagaagagattctggaaaacccggacttgtttctcaccagtgaagccacagattatggcagacagctccatgatgactatttctatcatgatgagctttaa
Sequence Length
954
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,139 Da
NCBI Official Full Name
Homo sapiens reticulocalbin 2, EF-hand calcium binding domain, mRNA
NCBI Official Synonym Full Names
reticulocalbin 2
NCBI Official Symbol
RCN2
NCBI Official Synonym Symbols
E6BP; ERC55; ERC-55; TCBP49
NCBI Protein Information
reticulocalbin-2
UniProt Protein Name
Reticulocalbin-2
Protein Family
UniProt Gene Name
RCN2
UniProt Synonym Gene Names
ERC55; E6BP
UniProt Entry Name
RCN2_HUMAN
NCBI Description
The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
Uniprot Description
RCN2: Not known. Binds calcium. Belongs to the CREC family.
Protein type: Endoplasmic reticulum
Chromosomal Location of Human Ortholog: 15q23
Cellular Component: endoplasmic reticulum; nucleolus
Molecular Function: protein binding
Research Articles on RCN2
Similar Products
Product Notes
The RCN2 rcn2 (Catalog #AAA1278108) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggctgg gcccgaggac cgcggcgttg gggctgctgc tgctgtgcgc cgccgcggcc ggcgccggca aggccgagga gctgcactac ccgctgggcg agcgccgcag cgactacgac cgcgaggcgc tgctgggcgt ccaggaagat gtggatgaat atgttaaact cggccacgaa gagcagcaaa aaagactgca ggcgatcata aagaaaatcg acttggactc agatggcttt ctcactgaaa gtgaactcag ttcatggatt cagatgtctt ttaagcatta tgctatgcaa gaagcaaaac aacagtttgt tgaatatgat aaaaacagtg atgatactgt gacttgggat gaatataaca ttcagatgta tgatcgtgtg attgactttg atgagaacac tgctctggat gatgcagaag aggagtcctt taggaagctt cacttaaagg acaagaagcg atttgaaaaa gctaaccagg attcaggtcc cggtttgagt cttgaagaat ttattgcttt tgagcatcct gaagaagttg attatatgac ggaatttgtc attcaagaag ctttagaaga acatgacaaa aatggtgatg gatttgttag tttggaagaa tttcttggtg attacaggtg ggatccaact gcaaatgaag atccagaatg gatacttgtt gagaaagaca gattcgtgaa tgattatgac aaagataacg atggcaggct tgatccccaa gagctgttac cttgggtagt acctaataat cagggcattg cacaagagga ggcacttcat ctaattgatg aaatggattt gaatggtgac aaaaagctct ctgaagaaga gattctggaa aacccggact tgtttctcac cagtgaagcc acagattatg gcagacagct ccatgatgac tatttctatc atgatgagct ttaa. It is sometimes possible for the material contained within the vial of "RCN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
