Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NRARP cdna clone

NRARP cDNA Clone

Synonyms
NRARP; NRARP cDNA Clone; NRARP cdna clone
Ordering
For Research Use Only!
Sequence
atgagccaggccgagctgtccacctgctccgcgccgcagacgcagcgcatcttccaggaggctgtgcgcaagggcaacacgcaggagctgcagtcgctgctgcagaacatgaccaactgcgagttcaacgtgaactcgttcgggcccgagggccagacggcgctgcaccagtcggtcatcgacggcaacctggagctcgtgaagctgctggtcaagttcggcgccgacatccgcctggccaaccgcgacggctggagcgcgctgcacatcgccgcgttcggtggccaccaggacatcgtgctctatctcatcaccaaggcgaagtacgcggccagcggccggtga
Sequence Length
345
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,492 Da
NCBI Official Full Name
Homo sapiens NOTCH-regulated ankyrin repeat protein, mRNA
NCBI Official Synonym Full Names
NOTCH-regulated ankyrin repeat protein
NCBI Official Symbol
NRARP
NCBI Protein Information
notch-regulated ankyrin repeat-containing protein
UniProt Protein Name
Notch-regulated ankyrin repeat-containing protein
UniProt Gene Name
NRARP
UniProt Entry Name
NRARP_HUMAN

Uniprot Description

NRARP: May play a role in the formation of somites. Belongs to the NRARP family.

Protein type: Cell development/differentiation

Chromosomal Location of Human Ortholog: 9q34.3

Biological Process: blood vessel endothelial cell proliferation during sprouting angiogenesis; negative regulation of Notch signaling pathway; Notch signaling pathway; patterning of blood vessels; positive regulation of endothelial cell proliferation

Research Articles on NRARP

Similar Products

Product Notes

The NRARP nrarp (Catalog #AAA1278104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccagg ccgagctgtc cacctgctcc gcgccgcaga cgcagcgcat cttccaggag gctgtgcgca agggcaacac gcaggagctg cagtcgctgc tgcagaacat gaccaactgc gagttcaacg tgaactcgtt cgggcccgag ggccagacgg cgctgcacca gtcggtcatc gacggcaacc tggagctcgt gaagctgctg gtcaagttcg gcgccgacat ccgcctggcc aaccgcgacg gctggagcgc gctgcacatc gccgcgttcg gtggccacca ggacatcgtg ctctatctca tcaccaaggc gaagtacgcg gccagcggcc ggtga. It is sometimes possible for the material contained within the vial of "NRARP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.