Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DVL1 cdna clone

DVL1 cDNA Clone

Gene Names
DVL1; DVL; DRS2; DVL1L1; DVL1P1
Synonyms
DVL1; DVL1 cDNA Clone; DVL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtggtgaaggaggagatctttgatgacaatgccaagcttccctgcttcaacggccgcgtggtctcctggctggtcctggctgagggtgctcactcggatgcggggtcccagggcacggacagccacacagacctgcccccgcctcttgagcggacaggcggcatcggggactcccggcccccctccttccacccgaatgtggccagcagccgtgacgggatggacaacgagacaggcacggagtccatggtcagtcaccggcgggagcgtgcccgacgccggaaccgcgaggaggccgcccggaccaatgggcacccaaggggagaccgacggcgggatgtggggctgcccccagacagcgcgtccaccgccctcagcagcgagcttgagtccagcagctttgtggactcggacgaggatggcagcacgagcaggctcagcagctccacggagcagagcacctcatccagactcacccggaagtacgccagcagcttgctgaagcacggcttcctgcggcacacggtcaacaagatcaccttctccgagcagtgctactacgtcttcggggatctctgcagcaatctcgccaccctgaacctcaacagtggctccagtgggacttcggatcaggacacgctggccccgctgccccacccggctgccccctggcctctgggtcagggctacccctaccagtacccgggacccccaccctgcttcccgcctgcctaccaggacccgggctttagctatggcagcggcagcaccgggagtcagcagagtgaagggagcaaaagcagtgggtccacccggagcagccgccgggccccgggccgtgagaaggagcgtcgggcggcgggagctgggggcagtggcagtgaatcggatcacacggcaccgagtggggtggggagcagctggcgagagcgtccggccggccagctcagccgtggcagcagcccacgcagtcaggcctcggctaccgccccggggctccccccgccccaccccacgaccaaggcctatacagtggtgggggggccacccgggggaccccctgtccgggagctggctgccgtccccccggaattgacaggcagccgccagtccttccagaaggctatggggaacccctgcgagttcttcgtggacatcatgtga
Sequence Length
1335
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,427 Da
NCBI Official Full Name
Homo sapiens dishevelled, dsh homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
dishevelled segment polarity protein 1
NCBI Official Symbol
DVL1
NCBI Official Synonym Symbols
DVL; DRS2; DVL1L1; DVL1P1
NCBI Protein Information
segment polarity protein dishevelled homolog DVL-1
UniProt Protein Name
Putative segment polarity protein dishevelled homolog DVL1P1
UniProt Gene Name
DVL1P1
UniProt Synonym Gene Names
DVL; DVL1; DVL1L1; Dishevelled-1-like
UniProt Entry Name
DVLP1_HUMAN

NCBI Description

DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development. [provided by RefSeq, Jul 2008]

Uniprot Description

DVL1L1: May play a role in the signal transduction pathway mediated by multiple Wnt genes. Belongs to the DSH family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p36

Cellular Component: cytoplasmic membrane-bound vesicle; cytoplasmic vesicle; cytosol; growth cone; lateral plasma membrane; neuron projection; synapse

Molecular Function: enzyme binding; frizzled binding; identical protein binding; protein binding; protein kinase binding

Biological Process: dendrite morphogenesis; negative regulation of protein binding; negative regulation of protein kinase activity; neural tube development; neuromuscular junction development; neurotransmitter secretion; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of transcription, DNA-dependent; positive regulation of Wnt receptor signaling pathway; protein stabilization; receptor clustering; regulation of neurotransmitter levels; synapse organization and biogenesis; synaptogenesis; transcription from RNA polymerase II promoter; Wnt receptor signaling pathway through beta-catenin; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on DVL1

Similar Products

Product Notes

The DVL1 dvl1p1 (Catalog #AAA1278096) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaga ccaagattat ctaccacatg gacgaggagg agacgccgta cctggtcaag ctgcccgtgg cccccgagcg cgtcacgctg gccgacttca agaacgtgct cagcaaccgg cccgtgcacg cctacaaatt cttctttaag tccatggacc aggacttcgg ggtggtgaag gaggagatct ttgatgacaa tgccaagctt ccctgcttca acggccgcgt ggtctcctgg ctggtcctgg ctgagggtgc tcactcggat gcggggtccc agggcacgga cagccacaca gacctgcccc cgcctcttga gcggacaggc ggcatcgggg actcccggcc cccctccttc cacccgaatg tggccagcag ccgtgacggg atggacaacg agacaggcac ggagtccatg gtcagtcacc ggcgggagcg tgcccgacgc cggaaccgcg aggaggccgc ccggaccaat gggcacccaa ggggagaccg acggcgggat gtggggctgc ccccagacag cgcgtccacc gccctcagca gcgagcttga gtccagcagc tttgtggact cggacgagga tggcagcacg agcaggctca gcagctccac ggagcagagc acctcatcca gactcacccg gaagtacgcc agcagcttgc tgaagcacgg cttcctgcgg cacacggtca acaagatcac cttctccgag cagtgctact acgtcttcgg ggatctctgc agcaatctcg ccaccctgaa cctcaacagt ggctccagtg ggacttcgga tcaggacacg ctggccccgc tgccccaccc ggctgccccc tggcctctgg gtcagggcta cccctaccag tacccgggac ccccaccctg cttcccgcct gcctaccagg acccgggctt tagctatggc agcggcagca ccgggagtca gcagagtgaa gggagcaaaa gcagtgggtc cacccggagc agccgccggg ccccgggccg tgagaaggag cgtcgggcgg cgggagctgg gggcagtggc agtgaatcgg atcacacggc accgagtggg gtggggagca gctggcgaga gcgtccggcc ggccagctca gccgtggcag cagcccacgc agtcaggcct cggctaccgc cccggggctc cccccgcccc accccacgac caaggcctat acagtggtgg gggggccacc cgggggaccc cctgtccggg agctggctgc cgtccccccg gaattgacag gcagccgcca gtccttccag aaggctatgg ggaacccctg cgagttcttc gtggacatca tgtga. It is sometimes possible for the material contained within the vial of "DVL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.