NACAP1 cdna clone
NACAP1 cDNA Clone
Gene Names
NACAP1; FKSG17
Synonyms
NACAP1; NACAP1 cDNA Clone; NACAP1 cdna clone
Sequence
atgcctggcgaagccacagaaaccgtccctgctatagagcagcagttgctgcagccccaggctgagacagggtctggaacagaatctgacagtgatgagtcagtaccagagcttgaagaacaggattccacccaggtaaccgcacaagtccagttggtggtagcagctgaaattgatgaagaaccagtcagtaaagcaaaacagaggcggagtgaaaagaaggcacggaaggctaggttcaaactgggtcttcaacaggttacaggagttactagagtcaccatccggaaatctaagaatatcctctttgtcatcacaaaaccagatgtctacaagagcccgcttcggatacctacatggtttttggggaagccaagattgaagatttatctcaggaagcacaactag
Sequence Length
408
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,306 Da
NCBI Official Full Name
Homo sapiens nascent-polypeptide-associated complex alpha polypeptide pseudogene 1, mRNA
NCBI Official Synonym Full Names
nascent polypeptide associated complex alpha subunit pseudogene 1
NCBI Official Symbol
NACAP1
NCBI Official Synonym Symbols
FKSG17
UniProt Protein Name
Putative nascent polypeptide-associated complex subunit alpha-like protein
UniProt Gene Name
NACAP1
UniProt Entry Name
NACP1_HUMAN
Uniprot Description
NACAP1: Belongs to the NAC-alpha family.
Chromosomal Location of Human Ortholog: 8q22.3
Similar Products
Product Notes
The NACAP1 nacap1 (Catalog #AAA1278081) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctggcg aagccacaga aaccgtccct gctatagagc agcagttgct gcagccccag gctgagacag ggtctggaac agaatctgac agtgatgagt cagtaccaga gcttgaagaa caggattcca cccaggtaac cgcacaagtc cagttggtgg tagcagctga aattgatgaa gaaccagtca gtaaagcaaa acagaggcgg agtgaaaaga aggcacggaa ggctaggttc aaactgggtc ttcaacaggt tacaggagtt actagagtca ccatccggaa atctaagaat atcctctttg tcatcacaaa accagatgtc tacaagagcc cgcttcggat acctacatgg tttttgggga agccaagatt gaagatttat ctcaggaagc acaactag. It is sometimes possible for the material contained within the vial of "NACAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
