ASCL4 cdna clone
ASCL4 cDNA Clone
Gene Names
ASCL4; HASH4; bHLHa44
Synonyms
ASCL4; ASCL4 cDNA Clone; ASCL4 cdna clone
Sequence
ATGGAGACGCGTAAACCGGCGGAACGGCTGGCCTTGCCATACTCGCTGCGCACCGCGCCCCTGGGCGTTCCGGGGACCCTGCCCGGACTCCCGCGGAGGGACCCCCTCAGGGTCGCCCTGCGTCTGGACGCCGCGTGCTGGGAGTGGGCGCGCAGCGGCTGCGCACGGGGATGGCAGTACTTGCCCGTGCCGCTGGACAGCGCCTTCGAGCCCGCCTTCCTCCGCAAGCGCAACGAGCGCGAGCGGCAGCGGGTGCGCTGCGTGAACGAGGGCTATGCGCGCCTCCGAGACCACCTGCCCCGGGAGCTGGCAGACAAGCGCCTCAGCAAAGTGGAGACGCTCCGCGCTGCCATCGACTACATCAAGCACCTGCAGGAGCTGCTGGAGCGCCAGGCCTGGGGGCTCGAGGGCGCGGCCGGCGCCGTCCCCCAGCGCAGGGCGGAATGCAACAGCGACGGGGAGTCCAAGGCCTCTTCGGCGCCTTCGCCCAGCAGCGAGCCCGAGGAGGGGGGCAGCTAG
Sequence Length
519
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,253 Da
NCBI Official Full Name
Homo sapiens achaete-scute complex homolog 4 (Drosophila), mRNA
NCBI Official Synonym Full Names
achaete-scute family bHLH transcription factor 4
NCBI Official Symbol
ASCL4
NCBI Official Synonym Symbols
HASH4; bHLHa44
NCBI Protein Information
achaete-scute homolog 4
UniProt Protein Name
Achaete-scute homolog 4
Protein Family
UniProt Gene Name
ASCL4
UniProt Synonym Gene Names
BHLHA44; HASH4; ASH-4; hASH4; bHLHa44
UniProt Entry Name
ASCL4_HUMAN
NCBI Description
Basic helix-loop-helix transcription factors, such as ASCL4, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]).[supplied by OMIM, Mar 2008]
Uniprot Description
ASCL4: Could be a transcriptional regulator involved in skin development.
Chromosomal Location of Human Ortholog: 12q23.3
Molecular Function: protein binding; transcription factor activity
Biological Process: regulation of transcription from RNA polymerase II promoter
Research Articles on ASCL4
Similar Products
Product Notes
The ASCL4 ascl4 (Catalog #AAA1278041) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGAGACGC GTAAACCGGC GGAACGGCTG GCCTTGCCAT ACTCGCTGCG CACCGCGCCC CTGGGCGTTC CGGGGACCCT GCCCGGACTC CCGCGGAGGG ACCCCCTCAG GGTCGCCCTG CGTCTGGACG CCGCGTGCTG GGAGTGGGCG CGCAGCGGCT GCGCACGGGG ATGGCAGTAC TTGCCCGTGC CGCTGGACAG CGCCTTCGAG CCCGCCTTCC TCCGCAAGCG CAACGAGCGC GAGCGGCAGC GGGTGCGCTG CGTGAACGAG GGCTATGCGC GCCTCCGAGA CCACCTGCCC CGGGAGCTGG CAGACAAGCG CCTCAGCAAA GTGGAGACGC TCCGCGCTGC CATCGACTAC ATCAAGCACC TGCAGGAGCT GCTGGAGCGC CAGGCCTGGG GGCTCGAGGG CGCGGCCGGC GCCGTCCCCC AGCGCAGGGC GGAATGCAAC AGCGACGGGG AGTCCAAGGC CTCTTCGGCG CCTTCGCCCA GCAGCGAGCC CGAGGAGGGG GGCAGCTAG. It is sometimes possible for the material contained within the vial of "ASCL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
