Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VDAC3 cdna clone

VDAC3 cDNA Clone

Gene Names
VDAC3; VDAC-3; HD-VDAC3
Synonyms
VDAC3; VDAC3 cDNA Clone; VDAC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtaacacaccaacgtactgtgacctaggaaaggctgctaaggatgtcttcaacaaaggatatggctttggcatggtcaagatagacctgaaaaccaagtcttgtagtggagtggaattttctacttctggtcatgcttacactgatacagggaaagcatcaggcaacctagaaaccaaatataaggtctgtaactatggacttaccttcacccagaaatggaacacagacaatactctagggacagaaatctcttgggagaataagttggctgaagggttgaaactgactcttgataccatatttgtaccgaacacaggaaagaagagtgggaaattgaaggcctcctataaacgggattgttttagtgttggcagtaatgttgatatagatttttctggaccaaccatctatggctgggctgtgttggccttcgaagggtggcttgctggctatcagatgagttttgacacagccaaatccaaactgtcacagaataatttcgccctgggttacaaggctgcggacttccagctgcacacacatgtgaacgatggcactgaatttggaggttctatctaccagaaggtgaatgagaagattgaaacatccataaaccttgcttggacagctgggagtaacaacacccgttttggcattgctgctaagtacatgctggattgtagaacttctctctctgctaaagtaaataatgccagcctgattggactgggttatactcagacccttcgaccaggagtcaaattgactttatcagctttaatcgatgggaagaacttcagtgcaggaggtcacaaggttggcttgggatttgaactggaagcttaa
Sequence Length
852
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,790 Da
NCBI Official Full Name
Homo sapiens voltage-dependent anion channel 3, mRNA
NCBI Official Synonym Full Names
voltage dependent anion channel 3
NCBI Official Symbol
VDAC3
NCBI Official Synonym Symbols
VDAC-3; HD-VDAC3
NCBI Protein Information
voltage-dependent anion-selective channel protein 3
UniProt Protein Name
Voltage-dependent anion-selective channel protein 3
UniProt Gene Name
VDAC3
UniProt Synonym Gene Names
VDAC-3; hVDAC3
UniProt Entry Name
VDAC3_HUMAN

NCBI Description

This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

VDAC3: a protein of the eukaryotic mitochondrial porin family. Forms a voltage-dependent anion channel through the mitochondrial outer membrane that allows diffusion of small hydrophilic molecules. Two splice-variant isoforms have been described.

Protein type: Mitochondrial; Membrane protein, integral; Channel, misc.

Chromosomal Location of Human Ortholog: 8p11.2

Cellular Component: mitochondrion; nucleus

Molecular Function: voltage-gated anion channel activity

Biological Process: adenine transport

Research Articles on VDAC3

Similar Products

Product Notes

The VDAC3 vdac3 (Catalog #AAA1278028) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtaaca caccaacgta ctgtgaccta ggaaaggctg ctaaggatgt cttcaacaaa ggatatggct ttggcatggt caagatagac ctgaaaacca agtcttgtag tggagtggaa ttttctactt ctggtcatgc ttacactgat acagggaaag catcaggcaa cctagaaacc aaatataagg tctgtaacta tggacttacc ttcacccaga aatggaacac agacaatact ctagggacag aaatctcttg ggagaataag ttggctgaag ggttgaaact gactcttgat accatatttg taccgaacac aggaaagaag agtgggaaat tgaaggcctc ctataaacgg gattgtttta gtgttggcag taatgttgat atagattttt ctggaccaac catctatggc tgggctgtgt tggccttcga agggtggctt gctggctatc agatgagttt tgacacagcc aaatccaaac tgtcacagaa taatttcgcc ctgggttaca aggctgcgga cttccagctg cacacacatg tgaacgatgg cactgaattt ggaggttcta tctaccagaa ggtgaatgag aagattgaaa catccataaa ccttgcttgg acagctggga gtaacaacac ccgttttggc attgctgcta agtacatgct ggattgtaga acttctctct ctgctaaagt aaataatgcc agcctgattg gactgggtta tactcagacc cttcgaccag gagtcaaatt gactttatca gctttaatcg atgggaagaa cttcagtgca ggaggtcaca aggttggctt gggatttgaa ctggaagctt aa. It is sometimes possible for the material contained within the vial of "VDAC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.