Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM41 cdna clone

TRIM41 cDNA Clone

Gene Names
TRIM41; RINCK
Synonyms
TRIM41; TRIM41 cDNA Clone; TRIM41 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccggatgttctgtcaggctgcgagagtggacctgacgctggaccctgacacggctcacccggccctgatgctgtcccctgaccgccggggggtccgcctggcagagcggcggcaggaggttgctgaccatcccaagcgcttctcggccgactgctgcgtactgggggcccagggcttccgctccggccggcactactgggaggtagaggtgggcgggcggcggggctgggcggtgggtgctgcccgtgaatcaacccatcataaggaaaaggtgggccctgggggttcctccgtgggcagcggggatgccagctcctcgcgccatcaccatcgccgccgccggctccacctgccccagcagcccctgctccagcgggaagtgtggtgcgtgggcaccaacggcaaacgctatcaggcccagagctccacagaacagacgctgctgagccccagtgagaaaccaaggcgctttggtgtgtacctggactatgaagctgggcgcctgggcttctacaacgcagagactctagcccacgtgcacaccttctcggctgccttcctgggcgagcgtgtctttcctttcttccgggtgctctccaagggcacccgcatcaagctctgcccttga
Sequence Length
633
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,491 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 41, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 41
NCBI Official Symbol
TRIM41
NCBI Official Synonym Symbols
RINCK
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM41
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM41
UniProt Gene Name
TRIM41
UniProt Synonym Gene Names
RINCK; RINCK
UniProt Entry Name
TRI41_HUMAN

NCBI Description

This gene encodes a member of the tripartite motif (TRIM) family. The TRIM family is characterized by a signature motif composed of a RING finger, one or more B-box domains, and a coiled-coil region. This encoded protein may play a role in protein kinase C signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

TRIM41: Functions as an E3 ligase that catalyzes the ubiquitin- mediated degradation of protein kinase C. Belongs to the TRIM/RBCC family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: nucleolus

Molecular Function: protein binding

Research Articles on TRIM41

Similar Products

Product Notes

The TRIM41 trim41 (Catalog #AAA1277848) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccgga tgttctgtca ggctgcgaga gtggacctga cgctggaccc tgacacggct cacccggccc tgatgctgtc ccctgaccgc cggggggtcc gcctggcaga gcggcggcag gaggttgctg accatcccaa gcgcttctcg gccgactgct gcgtactggg ggcccagggc ttccgctccg gccggcacta ctgggaggta gaggtgggcg ggcggcgggg ctgggcggtg ggtgctgccc gtgaatcaac ccatcataag gaaaaggtgg gccctggggg ttcctccgtg ggcagcgggg atgccagctc ctcgcgccat caccatcgcc gccgccggct ccacctgccc cagcagcccc tgctccagcg ggaagtgtgg tgcgtgggca ccaacggcaa acgctatcag gcccagagct ccacagaaca gacgctgctg agccccagtg agaaaccaag gcgctttggt gtgtacctgg actatgaagc tgggcgcctg ggcttctaca acgcagagac tctagcccac gtgcacacct tctcggctgc cttcctgggc gagcgtgtct ttcctttctt ccgggtgctc tccaagggca cccgcatcaa gctctgccct tga. It is sometimes possible for the material contained within the vial of "TRIM41, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.