Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDE1C cdna clone

PDE1C cDNA Clone

Gene Names
PDE1C; Hcam3; hCam-3; cam-PDE 1C
Synonyms
PDE1C; PDE1C cDNA Clone; PDE1C cdna clone
Ordering
For Research Use Only!
Sequence
atggagtcgccaacaaaggagattgaagaatttgagagcaactctctgaaatacctgcaaccggaacagatcgagaaaatctggcttcggctccgcgggctgaggaaatataagaaaacgtcccagagattacggtctttggtcaaacaattagagagaggggaagcttcagtggtagatcttaagaagaatttggaatatgcagccacagtgcttgaatctgtgtatattgatgaaacaaggagactcctggatacagaggatgagctcagtgacattcagtcagatgctgtgccttctgaggtccgagactggctggcctccaccttcacgcggcagatggggatgatgctcaggaggagcgacgagaagccccggttcaagagcatcgttcacgcagtgcaggctgggatatttgtggagagaatgtatagacggacatcaaacatggttggactgagctatccaccagctgttattgaggcattaaaggatgtggacaagtggtcatttgacgtcttttccctcaatgaggccagtggggatcatgcactgaaatttattttctatgaactactcacacgttatgatctgatcagccgtttcaagatccccatttctgcacttgtctcatttgtggaggccctggaagtgggatacagcaagcacaaaaatccttaccataacttaatgcacgctgccgatgttacacagacagtgcattacctcctctataagacaggagtggcgaactggctgacggagctggagatctttgctataatcttctcagctgccatccatgactacgagcataccggaaccaccaacaatttccacattcagactcggtctgatccagctattctgtataatgacagatctgtactggagaatcaccatttaagtgcagcttatcgccttctgcaagatgacgaggaaatgaatattttgattaacctctcaaaggatgactggagggagtttcgaaccttggtaattgaaatggtgatggccacagatatgtcttgtcacttccaacaaatcaaagcaatgaagactgctctgcagcagccagaagccattgaaaagccaaaagccttatcccttatgctgcatacagcagatattagccatccagcaaaagcatgggacctccatcatcgctggacaatgtcactcctggaggagttcttcagacagggtgacagagaagcagagctggggctgcctttttctcctctgtgtgaccgaaagtccactatggttgctcagtcacaagtaggtttcattgatttcatcgtggaacccaccttcactgtgcttacggacatgaccgagaagattgtgagtccattaatcgatgaaacctctcaaactggtgggacaggacagaggcgttcgagtttgaatagcatcagctcgtcagatgccaagcgatcaggtgtcaagacctctggttcagagggaagtgccccgatcaacaattctgtcatctccgttgactataagagctttaaagctacttggacggaagtggtgcacatcaatcgggagagatggagggccaaggtacccaaagaggagaaggccaagaaggaagcagaggaaaaggctcgcatggccgcagaggagcagcaaaaggaaatggaagccaaaagccaggctgaagaaggcgcatctggcaaagctgagaaaaagacgtctggagaaactaagaatcaagtcaatggaacacgggcaaacaaaagtgacaaccctcgtgggaaaaattccaaagccgagaagtcatcaggagaacagcaacagaatggtgacttcaaagatggtaaaaataagacagacaagaaggatcactctaacatcggaaatgattcaaagaaaacagatgattcacaagagtaa
Sequence Length
1905
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,896 Da
NCBI Official Full Name
Homo sapiens phosphodiesterase 1C, calmodulin-dependent 70kDa, mRNA
NCBI Official Synonym Full Names
phosphodiesterase 1C
NCBI Official Symbol
PDE1C
NCBI Official Synonym Symbols
Hcam3; hCam-3; cam-PDE 1C
NCBI Protein Information
calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1C
UniProt Protein Name
Calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1C
UniProt Gene Name
PDE1C
UniProt Synonym Gene Names
Cam-PDE 1C
UniProt Entry Name
PDE1C_HUMAN

NCBI Description

This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]

Uniprot Description

PDE1C: Cyclic nucleotide phosphodiesterase with a dual- specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. Has a high affinity for both cAMP and cGMP. Belongs to the cyclic nucleotide phosphodiesterase family. PDE1 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Phosphodiesterase; Nucleotide Metabolism - purine; EC 3.1.4.17

Chromosomal Location of Human Ortholog: 7p14.3

Cellular Component: cytosol

Molecular Function: calmodulin-dependent cyclic-nucleotide phosphodiesterase activity

Research Articles on PDE1C

Similar Products

Product Notes

The PDE1C pde1c (Catalog #AAA1277755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcgc caacaaagga gattgaagaa tttgagagca actctctgaa atacctgcaa ccggaacaga tcgagaaaat ctggcttcgg ctccgcgggc tgaggaaata taagaaaacg tcccagagat tacggtcttt ggtcaaacaa ttagagagag gggaagcttc agtggtagat cttaagaaga atttggaata tgcagccaca gtgcttgaat ctgtgtatat tgatgaaaca aggagactcc tggatacaga ggatgagctc agtgacattc agtcagatgc tgtgccttct gaggtccgag actggctggc ctccaccttc acgcggcaga tggggatgat gctcaggagg agcgacgaga agccccggtt caagagcatc gttcacgcag tgcaggctgg gatatttgtg gagagaatgt atagacggac atcaaacatg gttggactga gctatccacc agctgttatt gaggcattaa aggatgtgga caagtggtca tttgacgtct tttccctcaa tgaggccagt ggggatcatg cactgaaatt tattttctat gaactactca cacgttatga tctgatcagc cgtttcaaga tccccatttc tgcacttgtc tcatttgtgg aggccctgga agtgggatac agcaagcaca aaaatcctta ccataactta atgcacgctg ccgatgttac acagacagtg cattacctcc tctataagac aggagtggcg aactggctga cggagctgga gatctttgct ataatcttct cagctgccat ccatgactac gagcataccg gaaccaccaa caatttccac attcagactc ggtctgatcc agctattctg tataatgaca gatctgtact ggagaatcac catttaagtg cagcttatcg ccttctgcaa gatgacgagg aaatgaatat tttgattaac ctctcaaagg atgactggag ggagtttcga accttggtaa ttgaaatggt gatggccaca gatatgtctt gtcacttcca acaaatcaaa gcaatgaaga ctgctctgca gcagccagaa gccattgaaa agccaaaagc cttatccctt atgctgcata cagcagatat tagccatcca gcaaaagcat gggacctcca tcatcgctgg acaatgtcac tcctggagga gttcttcaga cagggtgaca gagaagcaga gctggggctg cctttttctc ctctgtgtga ccgaaagtcc actatggttg ctcagtcaca agtaggtttc attgatttca tcgtggaacc caccttcact gtgcttacgg acatgaccga gaagattgtg agtccattaa tcgatgaaac ctctcaaact ggtgggacag gacagaggcg ttcgagtttg aatagcatca gctcgtcaga tgccaagcga tcaggtgtca agacctctgg ttcagaggga agtgccccga tcaacaattc tgtcatctcc gttgactata agagctttaa agctacttgg acggaagtgg tgcacatcaa tcgggagaga tggagggcca aggtacccaa agaggagaag gccaagaagg aagcagagga aaaggctcgc atggccgcag aggagcagca aaaggaaatg gaagccaaaa gccaggctga agaaggcgca tctggcaaag ctgagaaaaa gacgtctgga gaaactaaga atcaagtcaa tggaacacgg gcaaacaaaa gtgacaaccc tcgtgggaaa aattccaaag ccgagaagtc atcaggagaa cagcaacaga atggtgactt caaagatggt aaaaataaga cagacaagaa ggatcactct aacatcggaa atgattcaaa gaaaacagat gattcacaag agtaa. It is sometimes possible for the material contained within the vial of "PDE1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.