SUPT7L cdna clone
SUPT7L cDNA Clone
Gene Names
SUPT7L; SPT7L; STAF65; SUPT7H; STAF65G; STAF65(gamma)
Synonyms
SUPT7L; SUPT7L cDNA Clone; SUPT7L cdna clone
Sequence
atgaatctgcaaagatactggggagagataccaatatcatcaagccagaccaacagaagttccttcgatttgctcccacgggagttccgtctggtggaagtccatgacccacccctgcaccaaccctcagccaacaagccgaagccccccactatgctggacatcccctcagagccatgtagtctcaccatccatacgattcagttgattcagcacaaccgacgtcttcgcaaccttattgccacagctcaggcccagaatcagcagcagacagaaggtgtaaaaactgaagagagtgaacctcttccctcgtgccctgggtcacctcctctccctgatgacctcctgcctttagattgtaagaatcccaatgcaccattccagatccggcacagtgacccagagagtgacttttatcgtgggaaaggggaacctgtgactgaactcagctggcactcctgtcggcagctcctctaccaggcagtggccacaatcctggcccacgcgggctttgactgtgctaatgagagtgtcctggagaccctaactgatgtggcacatgagtattgccttaagtttaccaagttgctgcgttttgctgtggaccgggaggcccggctgggacagactccttttcctgatgtgatggagcaggtattccatgaagtgggtattggcagtgtgctctccctccagaagttctggcagcaccgcatcaaggactatcacagttacatgctacagattagtaagcaactctctgaagaatatgaaaggattgtcaatcctgagaaggccacagaggacgctaaacctgtgaagatcaaggaggaacctgtgagcgacatcacttttcctgtcagtgaggagctggaggctgaccttgcttctggagaccagtcactgcctatgggagtgcttggggctcagagcgaacgcttcccatctaacctggaggttgaagcttcaccacaggcttcaagtgcagaggtaaatgcttctcctctttggaatctggcccatgtgaaaatggagcctcaagaaagtgaagaaggcaatgtctctgggcatggtgtgctgggcagtgatgtcttcgaggagcctatgtcaggcatgagtgaagctgggattcctcagagccctgatgactcagatagcagctatggttcccactccactgacagcctcatggggtcctcccctgttttcaaccagcgctgcaagaagaggatgaggaaaatataa
Sequence Length
1245
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,876 Da
NCBI Official Full Name
Homo sapiens suppressor of Ty 7 (S. cerevisiae)-like, mRNA
NCBI Official Synonym Full Names
SPT7-like STAGA complex gamma subunit
NCBI Official Symbol
SUPT7L
NCBI Official Synonym Symbols
SPT7L; STAF65; SUPT7H; STAF65G; STAF65(gamma)
NCBI Protein Information
STAGA complex 65 subunit gamma
UniProt Protein Name
STAGA complex 65 subunit gamma
Protein Family
UniProt Gene Name
SUPT7L
UniProt Synonym Gene Names
KIAA0764; STAF65gamma
UniProt Entry Name
ST65G_HUMAN
NCBI Description
SUPT7L is a protein subunit of the human STAGA complex (SPT3; (MIM 602947)/TAF9 (MIM 600822)/GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multiprotein complex (Martinez et al., 2001 [PubMed 11564863]).[supplied by OMIM, Apr 2009]
Uniprot Description
SUPT7L: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2p23.3
Cellular Component: nucleus
Molecular Function: histone acetyltransferase activity; protein binding; transcription coactivator activity
Biological Process: maintenance of protein localization in nucleus
Research Articles on SUPT7L
Similar Products
Product Notes
The SUPT7L supt7l (Catalog #AAA1277651) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatctgc aaagatactg gggagagata ccaatatcat caagccagac caacagaagt tccttcgatt tgctcccacg ggagttccgt ctggtggaag tccatgaccc acccctgcac caaccctcag ccaacaagcc gaagcccccc actatgctgg acatcccctc agagccatgt agtctcacca tccatacgat tcagttgatt cagcacaacc gacgtcttcg caaccttatt gccacagctc aggcccagaa tcagcagcag acagaaggtg taaaaactga agagagtgaa cctcttccct cgtgccctgg gtcacctcct ctccctgatg acctcctgcc tttagattgt aagaatccca atgcaccatt ccagatccgg cacagtgacc cagagagtga cttttatcgt gggaaagggg aacctgtgac tgaactcagc tggcactcct gtcggcagct cctctaccag gcagtggcca caatcctggc ccacgcgggc tttgactgtg ctaatgagag tgtcctggag accctaactg atgtggcaca tgagtattgc cttaagttta ccaagttgct gcgttttgct gtggaccggg aggcccggct gggacagact ccttttcctg atgtgatgga gcaggtattc catgaagtgg gtattggcag tgtgctctcc ctccagaagt tctggcagca ccgcatcaag gactatcaca gttacatgct acagattagt aagcaactct ctgaagaata tgaaaggatt gtcaatcctg agaaggccac agaggacgct aaacctgtga agatcaagga ggaacctgtg agcgacatca cttttcctgt cagtgaggag ctggaggctg accttgcttc tggagaccag tcactgccta tgggagtgct tggggctcag agcgaacgct tcccatctaa cctggaggtt gaagcttcac cacaggcttc aagtgcagag gtaaatgctt ctcctctttg gaatctggcc catgtgaaaa tggagcctca agaaagtgaa gaaggcaatg tctctgggca tggtgtgctg ggcagtgatg tcttcgagga gcctatgtca ggcatgagtg aagctgggat tcctcagagc cctgatgact cagatagcag ctatggttcc cactccactg acagcctcat ggggtcctcc cctgttttca accagcgctg caagaagagg atgaggaaaa tataa. It is sometimes possible for the material contained within the vial of "SUPT7L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
