Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDCA7L cdna clone

CDCA7L cDNA Clone

Gene Names
CDCA7L; R1; JPO2; RAM2
Synonyms
CDCA7L; CDCA7L cDNA Clone; CDCA7L cdna clone
Ordering
For Research Use Only!
Sequence
atggagttggcgactcgctaccagatccctaaagaagtggctgacatctttaacgcccccagtgatgatgaagagtttgttggcttccgagatgatgttcccatggaaaccctctcgtcagaggagagctgcgatagttttgactcactagagtcagggaaacaggatgtgcgctttcattccaaatacttcacagaagagctaagaagaatttttatagaggacactgactcagagactgaggattttgcaggatttacgcagagtgatctgaatggaaagactaacccagaagtaatggtcgtggagtcagatttgagtgatgatggcaaagcatctttggtgagcgaggaagaggaagatgaagaagaagataaggctacccctagaagaagcaggtctagaagaagtagtattggtcttcgagtagcctttcagttccccaccaagaagctggccaacaaaccagataaaaacagttcttccgagcagttgttttctagcgcacgcttacagaatgagaaaaaaacaattcttgaaagaaagaaagactgtagacaggtgatacaaagggaagattctacctctgagtctgaggatgactctcgggatgagagccaggagagttcagatgctttgctgaaaaggaccatgaacatcaaggagaacaaagccatgcttgcccagttattggcggaattgaactcgatgccagatttcttcccagtacgaaccccaacctcagcttctaggaagaagacagtgaggcgggccttctcggagggacagatcacgcggcgtatgaacccaacccggagtgcgcggcctcctgagaagtttgctctagagaacttcactgtctcagccgctaaatttgcggaagagttttacagcttccgaagaaggaagacaattggggggaaatgccgggagtacagacgacgtcaccgtatatcttcttttcggccagtggaggatatcaccgaagaggacttagaaaatgttgccataactgttcgagataaaatctatgataaagttctgggtaacacgtgccatcagtgtcgacaaaagaccatcgacaccaagacagtgtgtcggaaccagggttgctgtggtgtgcgaggacagttctgtggaccatgcctgcggaaccgctatggggaggatgtcagatcggcattgctggacccggattgggtgtgtcccccctgtcgtgggatctgcaattgcagctactgtcggaagcgtgacggccgctgtgccacaggaatcctcattcatctggccaagttttatggttatgacaatgttaaggaatatctggagagcttacaaaaggagctggtagaagacaattaa
Sequence Length
1362
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,779 Da
NCBI Official Full Name
Homo sapiens cell division cycle associated 7-like, mRNA
NCBI Official Synonym Full Names
cell division cycle associated 7 like
NCBI Official Symbol
CDCA7L
NCBI Official Synonym Symbols
R1; JPO2; RAM2
NCBI Protein Information
cell division cycle-associated 7-like protein
UniProt Protein Name
Cell division cycle-associated 7-like protein
UniProt Gene Name
CDCA7L
UniProt Synonym Gene Names
HR1; JPO2; R1
UniProt Entry Name
CDA7L_HUMAN

Uniprot Description

CDCA7L: Plays a role in transcriptional regulation as a repressor that inhibits monoamine oxidase A (MAOA) activity and gene expression by binding to the promoter. Plays an important oncogenic role in mediating the full transforming effect of MYC in medulloblastoma cells. Involved in apoptotic signaling pathways; May act downstream of P38-kinase and BCL-2, but upstream of CASP3/caspase-3 as well as CCND1/cyclin D1 and E2F1. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 7p15.3

Cellular Component: cytoplasm; nucleolus; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of cell proliferation

Research Articles on CDCA7L

Similar Products

Product Notes

The CDCA7L cdca7l (Catalog #AAA1277630) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttgg cgactcgcta ccagatccct aaagaagtgg ctgacatctt taacgccccc agtgatgatg aagagtttgt tggcttccga gatgatgttc ccatggaaac cctctcgtca gaggagagct gcgatagttt tgactcacta gagtcaggga aacaggatgt gcgctttcat tccaaatact tcacagaaga gctaagaaga atttttatag aggacactga ctcagagact gaggattttg caggatttac gcagagtgat ctgaatggaa agactaaccc agaagtaatg gtcgtggagt cagatttgag tgatgatggc aaagcatctt tggtgagcga ggaagaggaa gatgaagaag aagataaggc tacccctaga agaagcaggt ctagaagaag tagtattggt cttcgagtag cctttcagtt ccccaccaag aagctggcca acaaaccaga taaaaacagt tcttccgagc agttgttttc tagcgcacgc ttacagaatg agaaaaaaac aattcttgaa agaaagaaag actgtagaca ggtgatacaa agggaagatt ctacctctga gtctgaggat gactctcggg atgagagcca ggagagttca gatgctttgc tgaaaaggac catgaacatc aaggagaaca aagccatgct tgcccagtta ttggcggaat tgaactcgat gccagatttc ttcccagtac gaaccccaac ctcagcttct aggaagaaga cagtgaggcg ggccttctcg gagggacaga tcacgcggcg tatgaaccca acccggagtg cgcggcctcc tgagaagttt gctctagaga acttcactgt ctcagccgct aaatttgcgg aagagtttta cagcttccga agaaggaaga caattggggg gaaatgccgg gagtacagac gacgtcaccg tatatcttct tttcggccag tggaggatat caccgaagag gacttagaaa atgttgccat aactgttcga gataaaatct atgataaagt tctgggtaac acgtgccatc agtgtcgaca aaagaccatc gacaccaaga cagtgtgtcg gaaccagggt tgctgtggtg tgcgaggaca gttctgtgga ccatgcctgc ggaaccgcta tggggaggat gtcagatcgg cattgctgga cccggattgg gtgtgtcccc cctgtcgtgg gatctgcaat tgcagctact gtcggaagcg tgacggccgc tgtgccacag gaatcctcat tcatctggcc aagttttatg gttatgacaa tgttaaggaa tatctggaga gcttacaaaa ggagctggta gaagacaatt aa. It is sometimes possible for the material contained within the vial of "CDCA7L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.