Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNA14 cdna clone

GNA14 cDNA Clone

Synonyms
GNA14; GNA14 cDNA Clone; GNA14 cdna clone
Ordering
For Research Use Only!
Sequence
atggccggctgctgctgcctgtccgcggaggagaaggagtcgcagcgcatcagcgcggagatcgagcgacagcttcgtcgggacaagaaggacgcgcgccgtgagcttaagctgctgctgctgggaactggtgaaagtgggaaaagcacctttatcaagcagatgagaattatccatgggtctggttacagcgacgaagacagaaaggggttcacgaagctggtttaccaaaacatattcaccgccatgcaagccatgatcagagcgatggacacgctaaggatacagtatgtgtgtgaacagaataaggaaaatgcccagataatcagagaagtggaagtggacaaggtctccatgctctccagggagcaggtggaggccatcaagcagctctggcaagatccaggcatccaggagtgttacgacaggaggagggagtaccagctgtcggactctgccaaatattacctgactgacattgaccgcatcgccacaccatcattcgtgcctacccaacaagatgtgcttcgcgtccgagtgcccaccaccggcatcattgagtatccatttgacttggaaaacatcatctttcggatggtggatgttggtggccaacgatcggaaagacggaagtggattcactgctttgagagtgtcacctccattattttcttggttgctctgagtgaatatgaccaggtcctggctgagtgtgacaacgagaatcgcatggaagagagcaaagccttatttaaaaccatcatcacctacccctggtttctgaattcgtctgtgattttattcttgaacaagaaggatcttttggaagagaaaatcatgtactctcatctaattagctatttcccagaatacacaggaccgaaacaggatgtcagagctgccagagactttatcctgaagctttaccaagatcagaatcctgacaaagagaaagtcatctactctcacttcacatgtgctacagatacagacaatattcgctttgtgtttgctgctgtcaaagacacaattctacagctaaacctaagggaattcaaccttgtctaa
Sequence Length
1068
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,571 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha 14, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha 14
NCBI Official Symbol
GNA14
NCBI Protein Information
guanine nucleotide-binding protein subunit alpha-14
UniProt Protein Name
Guanine nucleotide-binding protein subunit alpha-14
UniProt Gene Name
GNA14
UniProt Synonym Gene Names
G alpha-14; G-protein subunit alpha-14
UniProt Entry Name
GNA14_HUMAN

NCBI Description

This gene encodes a member of the guanine nucleotide-binding, or G protein family. G proteins are heterotrimers consisting of alpha, beta and gamma subunits. The encoded protein is a member of the alpha family of G proteins, more specifically the alpha q subfamily of G proteins. The encoded protein may play a role in pertussis-toxin resistant activation of phospholipase C-beta and its downstream effectors.[provided by RefSeq, Feb 2009]

Uniprot Description

G-alpha 14: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. Belongs to the G-alpha family. G(q) subfamily.

Protein type: G protein, heterotrimeric alpha G(q); G protein; G protein, heterotrimeric

Chromosomal Location of Human Ortholog: 9q21

Cellular Component: heterotrimeric G-protein complex; plasma membrane

Molecular Function: GTPase activity; protein binding

Biological Process: dopamine receptor, phospholipase C activating pathway; platelet activation; signal transduction

Research Articles on GNA14

Similar Products

Product Notes

The GNA14 gna14 (Catalog #AAA1277623) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggct gctgctgcct gtccgcggag gagaaggagt cgcagcgcat cagcgcggag atcgagcgac agcttcgtcg ggacaagaag gacgcgcgcc gtgagcttaa gctgctgctg ctgggaactg gtgaaagtgg gaaaagcacc tttatcaagc agatgagaat tatccatggg tctggttaca gcgacgaaga cagaaagggg ttcacgaagc tggtttacca aaacatattc accgccatgc aagccatgat cagagcgatg gacacgctaa ggatacagta tgtgtgtgaa cagaataagg aaaatgccca gataatcaga gaagtggaag tggacaaggt ctccatgctc tccagggagc aggtggaggc catcaagcag ctctggcaag atccaggcat ccaggagtgt tacgacagga ggagggagta ccagctgtcg gactctgcca aatattacct gactgacatt gaccgcatcg ccacaccatc attcgtgcct acccaacaag atgtgcttcg cgtccgagtg cccaccaccg gcatcattga gtatccattt gacttggaaa acatcatctt tcggatggtg gatgttggtg gccaacgatc ggaaagacgg aagtggattc actgctttga gagtgtcacc tccattattt tcttggttgc tctgagtgaa tatgaccagg tcctggctga gtgtgacaac gagaatcgca tggaagagag caaagcctta tttaaaacca tcatcaccta cccctggttt ctgaattcgt ctgtgatttt attcttgaac aagaaggatc ttttggaaga gaaaatcatg tactctcatc taattagcta tttcccagaa tacacaggac cgaaacagga tgtcagagct gccagagact ttatcctgaa gctttaccaa gatcagaatc ctgacaaaga gaaagtcatc tactctcact tcacatgtgc tacagataca gacaatattc gctttgtgtt tgctgctgtc aaagacacaa ttctacagct aaacctaagg gaattcaacc ttgtctaa. It is sometimes possible for the material contained within the vial of "GNA14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.