ZNF561 cdna clone
ZNF561 cDNA Clone
Synonyms
ZNF561; ZNF561 cDNA Clone; ZNF561 cdna clone
Sequence
atgctggagaactacatgaacctggcctctgtggaatgggaaatacaacctagaaccaaacggtcatcacttcagcagggttttttgaagaatcaaatattcagtgggatacaaatgacaagaggctacagtggatggaaactctgtgactgtaagaattgtggagaggtcttcagggaacagttttgccttaagacacacatgagagttcagaatggagggaatacttctgagggtaattgttatggaaaagacaccctcagtgtgcacaaggaagcctctactggacaggaactttccaaatttaatccatgtggaaaagtctttactctaactccaggtcttgctgtacatcttgaagttctcaatgcaagacaaccctacaaatgtaaggaatgtggaaaaggctttaagtattttgcaagccttgataatcatatgggaatccacactgatgagaaactctgtgaatttcaggaatatgggagagctgtcacagcttcttcacacctaaagcagtgtgtagcagttcatacaggaaagaaatccaaaaagactaagaaatgtgggaaatccttcactaatttttctcaactttatgcacctgtgaaaactcataaaggagagaagtcctttgaatgtaaagaatgtggaagatcctttagaaattcctcatgccttaatgatcacattcaaattcacactggaataaaaccacacaagtgtacttactgtgggaaagccttcactagatcaactcaacttactgaacatgtaagaactcacactggaataaaaccctatgaatgtaaggaatgtggccaagcctttgctcagtactcgggcctttctatacacatacgaagtcacagtggaaagaaaccctatcagtgtaaggaatgtgggaaagccttcactacatccacaagtcttattcagcatacaagaattcacacaggagagaagccttatgaatgtgttgaatgtgggaagaccttcattacttcttcccgtcgtagtaaacatttgaaaactcatagtggagaaaagccctttgtatgcaagatatgtgggaaagcatttctatattcctcacgccttaatgttcacctgcgaactcataccggagagaaacccttcgtatgtaaagaatgtgggaaagcatttgctgtttcctcacgcctaagtagacatgaaagaattcacactggggagaaaccctatgaatgcaaggatatgagtgttaccatttag
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,225 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 561, mRNA
NCBI Official Synonym Full Names
zinc finger protein 561
NCBI Official Symbol
ZNF561
NCBI Protein Information
zinc finger protein 561
UniProt Protein Name
Zinc finger protein 561
Protein Family
UniProt Gene Name
ZNF561
UniProt Entry Name
ZN561_HUMAN
Uniprot Description
ZNF561: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; Transcription regulation; DNA-binding
Chromosomal Location of Human Ortholog: 19p13.2
Molecular Function: transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Similar Products
Product Notes
The ZNF561 znf561 (Catalog #AAA1277613) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaga actacatgaa cctggcctct gtggaatggg aaatacaacc tagaaccaaa cggtcatcac ttcagcaggg ttttttgaag aatcaaatat tcagtgggat acaaatgaca agaggctaca gtggatggaa actctgtgac tgtaagaatt gtggagaggt cttcagggaa cagttttgcc ttaagacaca catgagagtt cagaatggag ggaatacttc tgagggtaat tgttatggaa aagacaccct cagtgtgcac aaggaagcct ctactggaca ggaactttcc aaatttaatc catgtggaaa agtctttact ctaactccag gtcttgctgt acatcttgaa gttctcaatg caagacaacc ctacaaatgt aaggaatgtg gaaaaggctt taagtatttt gcaagccttg ataatcatat gggaatccac actgatgaga aactctgtga atttcaggaa tatgggagag ctgtcacagc ttcttcacac ctaaagcagt gtgtagcagt tcatacagga aagaaatcca aaaagactaa gaaatgtggg aaatccttca ctaatttttc tcaactttat gcacctgtga aaactcataa aggagagaag tcctttgaat gtaaagaatg tggaagatcc tttagaaatt cctcatgcct taatgatcac attcaaattc acactggaat aaaaccacac aagtgtactt actgtgggaa agccttcact agatcaactc aacttactga acatgtaaga actcacactg gaataaaacc ctatgaatgt aaggaatgtg gccaagcctt tgctcagtac tcgggccttt ctatacacat acgaagtcac agtggaaaga aaccctatca gtgtaaggaa tgtgggaaag ccttcactac atccacaagt cttattcagc atacaagaat tcacacagga gagaagcctt atgaatgtgt tgaatgtggg aagaccttca ttacttcttc ccgtcgtagt aaacatttga aaactcatag tggagaaaag ccctttgtat gcaagatatg tgggaaagca tttctatatt cctcacgcct taatgttcac ctgcgaactc ataccggaga gaaacccttc gtatgtaaag aatgtgggaa agcatttgct gtttcctcac gcctaagtag acatgaaaga attcacactg gggagaaacc ctatgaatgc aaggatatga gtgttaccat ttag. It is sometimes possible for the material contained within the vial of "ZNF561, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
