Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLF17 cdna clone

KLF17 cDNA Clone

Gene Names
KLF17; ZNF393; Zfp393
Synonyms
KLF17; KLF17 cDNA Clone; KLF17 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacggccgaccgcaggctgagatggaacaggaggctggggagctgagccggtggcaggcggcgcaccaggctgcccaggataacgagaactcagcgcccatcttgaacatgtcttcatcttctggaagctctggagtgcacacctcttggaaccaaggcctaccaaccattcagcactttcctcacagcgcagagatgctggggtcccctttggtgtctgttgaggcgccggggcagaatgtgaatgaaggggggccacagttcagtatgccactgcctgagcgtggtatgagctactgcccccaagcgactctcactccttcccggatgatttactgtcagagaatgtctccccctcagcaagagatgacgattttcagtgggccccaactaatgcccgtaggagagcccaatattccaagggtagccaggcccttcggtgggaatctaaggatgccccccagtgggctgccagtctcagcttccactggaatcccaataatgtcccacactgggaaccctccagtgccttaccctggcctctcgacagtaccttctgacgaaacattgttgggcccgactgtgccttccactgaggcccaggcagtgctcccctccatggctcagatgttgcccccgcaagatgcccatgaccttgggatgcccccagctgagtcccagtcattgctggttttaggatctcaggactctcttgtcagtcagccagactctcaagaaggcccatttctaccagagcagcccggacctgctccacagacagtagagaagaactccaggcctcaggaagggactggtagaaggggctcctcagaggcaaggccttactgctgcaactacgagaactgcggaaaagcttataccaaacgctcccacctcgtgagccaccagcgcaagcacacaggtgagaggccatattcttgcaactgggaaagttgttcatggtctttcttccgttctgatgagcttagacgacatatgcgggtacacaccagatatcgaccatataaatgtgatcagtgcagccgggagttcatgaggtctgaccatctcaagcaacaccagaagactcatcggccgggaccctcagacccacaggccaacaacaacaatggagagcaggacagtcctcctgctgctggtccttag
Sequence Length
1170
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,577 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 17, mRNA
NCBI Official Synonym Full Names
Kruppel like factor 17
NCBI Official Symbol
KLF17
NCBI Official Synonym Symbols
ZNF393; Zfp393
NCBI Protein Information
Krueppel-like factor 17
UniProt Protein Name
Krueppel-like factor 17
Protein Family
UniProt Gene Name
KLF17
UniProt Synonym Gene Names
ZNF393
UniProt Entry Name
KLF17_HUMAN

Uniprot Description

KLF17: Transcription repressor that binds to the promoter of target genes and prevents their expression. Acts as a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer. Specifically binds the 5'-CACCC-3' sequence in the promoter of ID1, a key metastasis regulator in breast cancer, and repress its expression. May be a germ cell-specific transcription factor that plays important roles in spermatid differentiation and oocyte development. Belongs to the Sp1 C2H2-type zinc-finger protein family.

Protein type: DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 1p34.1

Molecular Function: protein binding; transcription factor activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Research Articles on KLF17

Similar Products

Product Notes

The KLF17 klf17 (Catalog #AAA1277531) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacggcc gaccgcaggc tgagatggaa caggaggctg gggagctgag ccggtggcag gcggcgcacc aggctgccca ggataacgag aactcagcgc ccatcttgaa catgtcttca tcttctggaa gctctggagt gcacacctct tggaaccaag gcctaccaac cattcagcac tttcctcaca gcgcagagat gctggggtcc cctttggtgt ctgttgaggc gccggggcag aatgtgaatg aaggggggcc acagttcagt atgccactgc ctgagcgtgg tatgagctac tgcccccaag cgactctcac tccttcccgg atgatttact gtcagagaat gtctccccct cagcaagaga tgacgatttt cagtgggccc caactaatgc ccgtaggaga gcccaatatt ccaagggtag ccaggccctt cggtgggaat ctaaggatgc cccccagtgg gctgccagtc tcagcttcca ctggaatccc aataatgtcc cacactggga accctccagt gccttaccct ggcctctcga cagtaccttc tgacgaaaca ttgttgggcc cgactgtgcc ttccactgag gcccaggcag tgctcccctc catggctcag atgttgcccc cgcaagatgc ccatgacctt gggatgcccc cagctgagtc ccagtcattg ctggttttag gatctcagga ctctcttgtc agtcagccag actctcaaga aggcccattt ctaccagagc agcccggacc tgctccacag acagtagaga agaactccag gcctcaggaa gggactggta gaaggggctc ctcagaggca aggccttact gctgcaacta cgagaactgc ggaaaagctt ataccaaacg ctcccacctc gtgagccacc agcgcaagca cacaggtgag aggccatatt cttgcaactg ggaaagttgt tcatggtctt tcttccgttc tgatgagctt agacgacata tgcgggtaca caccagatat cgaccatata aatgtgatca gtgcagccgg gagttcatga ggtctgacca tctcaagcaa caccagaaga ctcatcggcc gggaccctca gacccacagg ccaacaacaa caatggagag caggacagtc ctcctgctgc tggtccttag. It is sometimes possible for the material contained within the vial of "KLF17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.