Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Test Data

GNPTG cdna clone

GNPTG cDNA Clone

Gene Names
GNPTG; RJD9; GNPTAG; LP2537; C16orf27
Synonyms
GNPTG; GNPTG cDNA Clone; GNPTG cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggggctggcgcggctcctgttgctcctcgggctctcggccggcgggcccgcgccggcaggtgcagcgaagatgaaggtggtggaggagcccaacgcgtttggggtgaacaacccgttcttgcctcaggccagtcgcctccaggccaagagggatccttcacccgtgtctggacccgtgcatctcttccgactctcgggcaagtgcttcagcctggtggagtccacgtacaagtatgagttctgcccgttccacaacgtgacccagcacgagcagaccttccgctggaacgcctacagtgggatcctcggcatctggcacgagtgggagatcgccaacaacaccttcacgggcatgtggatgagggacggtgacgcctgccgttcccggagccggcagagcaaggtggagctggcgtgtggaaaaagcaaccggctggcccatgtgtccgagccgagcacctgcgtctacgcgctgacgttcgagacccccctcgtctgccacccccacgccttgctagtgtacccaaccctgccagaggccctgcagcggcagtgggaccaggtagagcaggacctggccgatgagctgatcaccccccagggccatgagaagttgctgaggacactttttgaggatgctggctacttaaagaccccagaaaatgaacccacccagctggagggaggtcctgacagcttggggtttgagaccctggaaaactgcaggaaggctcataaagaactctcaaaggagatcaaaaggctgaaaggtttgctcacccagcacggcatcccctacacgaggcccacagaaacttccaacttggagcacttgggccacgagacgcccagagccaagtctccagagcagctgcggggtgacccaggactgcgtgggagtttgtga
Sequence Length
915
Vector
Please Inquire

Test Data

Test Data

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,974 Da
NCBI Official Full Name
Homo sapiens N-acetylglucosamine-1-phosphate transferase, gamma subunit, mRNA
NCBI Official Synonym Full Names
N-acetylglucosamine-1-phosphate transferase gamma subunit
NCBI Official Symbol
GNPTG
NCBI Official Synonym Symbols
RJD9; GNPTAG; LP2537; C16orf27
NCBI Protein Information
N-acetylglucosamine-1-phosphotransferase subunit gamma
UniProt Protein Name
N-acetylglucosamine-1-phosphotransferase subunit gamma
UniProt Gene Name
GNPTG
UniProt Synonym Gene Names
C16orf27; GNPTAG
UniProt Entry Name
GNPTG_HUMAN

NCBI Description

This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]

Uniprot Description

GNPTG: the gamma subunit of N-acetylglucosamine-1-phosphotransferase. May recognize the substrate of GlcNAc-1-phosphotransferase but also lysosomal proteins with mannose-6-phosphate residues. Defects in GNPTG cause a variant of pseudo-Hurler polydystrophy, an autosomal recessive disease of lysosomal hydrolase trafficking.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: Golgi apparatus

Molecular Function: protein homodimerization activity

Biological Process: carbohydrate phosphorylation

Disease: Mucolipidosis Iii Gamma

Research Articles on GNPTG

Similar Products

Product Notes

The GNPTG gnptg (Catalog #AAA1277530) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ggctggcgcg gctcctgttg ctcctcgggc tctcggccgg cgggcccgcg ccggcaggtg cagcgaagat gaaggtggtg gaggagccca acgcgtttgg ggtgaacaac ccgttcttgc ctcaggccag tcgcctccag gccaagaggg atccttcacc cgtgtctgga cccgtgcatc tcttccgact ctcgggcaag tgcttcagcc tggtggagtc cacgtacaag tatgagttct gcccgttcca caacgtgacc cagcacgagc agaccttccg ctggaacgcc tacagtggga tcctcggcat ctggcacgag tgggagatcg ccaacaacac cttcacgggc atgtggatga gggacggtga cgcctgccgt tcccggagcc ggcagagcaa ggtggagctg gcgtgtggaa aaagcaaccg gctggcccat gtgtccgagc cgagcacctg cgtctacgcg ctgacgttcg agacccccct cgtctgccac ccccacgcct tgctagtgta cccaaccctg ccagaggccc tgcagcggca gtgggaccag gtagagcagg acctggccga tgagctgatc accccccagg gccatgagaa gttgctgagg acactttttg aggatgctgg ctacttaaag accccagaaa atgaacccac ccagctggag ggaggtcctg acagcttggg gtttgagacc ctggaaaact gcaggaaggc tcataaagaa ctctcaaagg agatcaaaag gctgaaaggt ttgctcaccc agcacggcat cccctacacg aggcccacag aaacttccaa cttggagcac ttgggccacg agacgcccag agccaagtct ccagagcagc tgcggggtga cccaggactg cgtgggagtt tgtga. It is sometimes possible for the material contained within the vial of "GNPTG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.