FMNL1 cdna clone
FMNL1 cDNA Clone
Gene Names
FMNL1; FMNL; FHOD4; KW-13; C17orf1; C17orf1B
Synonyms
FMNL1; FMNL1 cDNA Clone; FMNL1 cdna clone
Sequence
atgccactcttgaactgggtggcactgaaacccagccagatcaccggcactgtcttcacagagctcaatgatgagaaggtgctgcaggagctagacatgagtgattttgaggaacagttcaagaccaagtcccaaggccccagcctggacctcagcgctctcaagagtaaggcagcccagaaggcccccagcaaggcgacactcattgaggccaaccgggccaagaacttggccatcaccctgcggaagggcaacctgggggccgagcgcatctgccaagccattgaggcgtacgacctgcaggctctgggcctggacttcctggagctgctgatgcgcttcctgcccacagagtatgagcgcagcctcatcacccgctttgagcgggagcagcggccaatggaggagctgtcagaggaggaccgcttcatgctatgcttcagccgcatcccgcgcctgccggagcgcatgaccacactcaccttcctgggcaacttcccggacacagcccagctgctcatgccgcaactgaatgccatcattgcagcctcaatgtccatcaagtcctctgacaaactccgccagatcctggagattgtcctggcctttggcaactacatgaacagtagcaagcgtggggcagcctatggcttccggctccagagcctggatgcgctgttggagatgaagtcgactgatcgcaagcagacgctgctgcactacctggtgaaggtcattgctgagaagtacccgcaactcacaggcttccacagcgacctgcacttcctggacaaggcgggctcagtgtccctggacagtgtcctggcggacgtgcgctccctgcagcgaggcctagagttgacacagagagagtttgtgcggcaggatgactgcatggtgctcaaggagttcctgagggccaactcgcccaccatggacaagctgctggcagacagcaagacggctcaggaggcctttgagtctgtggtggagtacttcggagagaaccccaagaccacatccccaggcctgttcttctccctctttagccgcttcattaaggcctacaagaaagctgagcaggaggtggaacagtggaaaaaagaagccgctgcccaggaggcaggcgctgataccccgggcaaaggggagcccccagcacccaagtcaccgccaaaggcccggcggccacagatggacctcatctctgagctgaaacggaggcagcagaaggagccactcatttatgagagcgaccgtgatggggccattgaagacatcatcacagatctgcggaaccagccctacatccgcgcagacacaggccgccgcagtgcccgtcggcgtcccccgggccccccactgcaggtcacctccgaagtctcgctgtag
Sequence Length
1392
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
128,335 Da
NCBI Official Full Name
Homo sapiens formin-like 1, mRNA
NCBI Official Synonym Full Names
formin like 1
NCBI Official Symbol
FMNL1
NCBI Official Synonym Symbols
FMNL; FHOD4; KW-13; C17orf1; C17orf1B
NCBI Protein Information
formin-like protein 1
UniProt Protein Name
Formin-like protein 1
UniProt Gene Name
FMNL1
UniProt Synonym Gene Names
C17orf1; C17orf1B; FMNL; FRL1
UniProt Entry Name
FMNL1_HUMAN
NCBI Description
This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
FMNL1: May play a role in the control of cell motility and survival of macrophages. Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the cortical actin filament dynamics and cell shape. Belongs to the formin homology family. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 17q21
Cellular Component: cytosol; membrane; phagocytic vesicle; plasma membrane
Molecular Function: actin filament binding; GTPase activating protein binding; protein binding; Rac GTPase binding
Biological Process: actin filament severing; cortical actin cytoskeleton organization and biogenesis; regulation of cell shape
Research Articles on FMNL1
Similar Products
Product Notes
The FMNL1 fmnl1 (Catalog #AAA1277528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactct tgaactgggt ggcactgaaa cccagccaga tcaccggcac tgtcttcaca gagctcaatg atgagaaggt gctgcaggag ctagacatga gtgattttga ggaacagttc aagaccaagt cccaaggccc cagcctggac ctcagcgctc tcaagagtaa ggcagcccag aaggccccca gcaaggcgac actcattgag gccaaccggg ccaagaactt ggccatcacc ctgcggaagg gcaacctggg ggccgagcgc atctgccaag ccattgaggc gtacgacctg caggctctgg gcctggactt cctggagctg ctgatgcgct tcctgcccac agagtatgag cgcagcctca tcacccgctt tgagcgggag cagcggccaa tggaggagct gtcagaggag gaccgcttca tgctatgctt cagccgcatc ccgcgcctgc cggagcgcat gaccacactc accttcctgg gcaacttccc ggacacagcc cagctgctca tgccgcaact gaatgccatc attgcagcct caatgtccat caagtcctct gacaaactcc gccagatcct ggagattgtc ctggcctttg gcaactacat gaacagtagc aagcgtgggg cagcctatgg cttccggctc cagagcctgg atgcgctgtt ggagatgaag tcgactgatc gcaagcagac gctgctgcac tacctggtga aggtcattgc tgagaagtac ccgcaactca caggcttcca cagcgacctg cacttcctgg acaaggcggg ctcagtgtcc ctggacagtg tcctggcgga cgtgcgctcc ctgcagcgag gcctagagtt gacacagaga gagtttgtgc ggcaggatga ctgcatggtg ctcaaggagt tcctgagggc caactcgccc accatggaca agctgctggc agacagcaag acggctcagg aggcctttga gtctgtggtg gagtacttcg gagagaaccc caagaccaca tccccaggcc tgttcttctc cctctttagc cgcttcatta aggcctacaa gaaagctgag caggaggtgg aacagtggaa aaaagaagcc gctgcccagg aggcaggcgc tgataccccg ggcaaagggg agcccccagc acccaagtca ccgccaaagg cccggcggcc acagatggac ctcatctctg agctgaaacg gaggcagcag aaggagccac tcatttatga gagcgaccgt gatggggcca ttgaagacat catcacagat ctgcggaacc agccctacat ccgcgcagac acaggccgcc gcagtgcccg tcggcgtccc ccgggccccc cactgcaggt cacctccgaa gtctcgctgt ag. It is sometimes possible for the material contained within the vial of "FMNL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
