USP12 cdna clone
USP12 cDNA Clone
Gene Names
USP12; UBH1; USP12L1
Synonyms
USP12; USP12 cDNA Clone; USP12 cdna clone
Sequence
atggaaatcctaatgacagtctccaaattcgcctccatctgtaccatgggcgccaatgcttcggcattagagaaagagattggtccagaacagtttccggtcaatgagcactattttggattagtcaattttgggaatacctgctactgcaattcagttcttcaagcactttatttttgtcgtccatttcgggaaaaagttcttgcgtataagagtcaacctaggaaaaaggagagccttcttacatgcttagcagatctcttccatagcatagccactcagaagaaaaaggttggagtaataccccctaagaagttcatcacaagattacggaaagaaaatgagctttttgacaactacatgcaacaagatgcccatgaattcttaaattacctactaaatacaattgctgatattttacaagaagagagaaagcaggaaaaacaaaatggtcgtttacctaatggtaatattgataatgaaaataataacagcacaccagacccaacgtgggttgatgagatttttcagggaacattaactaatgaaaccagatgtcttacttgtgaaactataagcagcaaagatgaagattttttagacctttctgttgacgtggaacaaaatacatcaattactcactgcttaaggggtttcagcaacacagaaactctgtgcagtgaatacaagtattactgtgaagagtgtcgcagcaaacaggaagcacacaaacggatgaaagttaaaaaactgcccatgattctagctctacacctgaagagatttaaatatatggatcaacttcatcgatatacaaaactctcttaccgggtagtttttcctttagaacttcgtctgtttaacacttcaggtgatgccaccaatccagacagaatgtacgaccttgttgctgttgtggttcactgtggaagtggtcccaatcgaggccattatattgcaatagttaagagtcatgatttttggttgttgtttgatgacgacattgtagaaaaaatagatgcacaagctattgaagaattctacgggttgacatcagatatctcaaagaactctgagtctggttacatccttttctatcagtctcgggactga
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,858 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 12, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 12
NCBI Official Symbol
USP12
NCBI Official Synonym Symbols
UBH1; USP12L1
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 12
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 12
UniProt Gene Name
USP12
UniProt Synonym Gene Names
UBH1; USP12L1
UniProt Entry Name
UBP12_HUMAN
Uniprot Description
USP12: Deubiquitinating enzyme. Has almost no deubiquitinating activity by itself and requires the interaction with WDR48 to have a high activity. Not involved in deubiquitination of monoubiquitinated FANCD2. Belongs to the peptidase C19 family. USP12/USP46 subfamily.
Protein type: Ubiquitin-specific protease; Protease; EC 3.4.19.12; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 13q12.13
Molecular Function: cysteine-type endopeptidase activity; protein binding; ubiquitin-specific protease activity
Biological Process: protein deubiquitination
Research Articles on USP12
Similar Products
Product Notes
The USP12 usp12 (Catalog #AAA1277504) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaatcc taatgacagt ctccaaattc gcctccatct gtaccatggg cgccaatgct tcggcattag agaaagagat tggtccagaa cagtttccgg tcaatgagca ctattttgga ttagtcaatt ttgggaatac ctgctactgc aattcagttc ttcaagcact ttatttttgt cgtccatttc gggaaaaagt tcttgcgtat aagagtcaac ctaggaaaaa ggagagcctt cttacatgct tagcagatct cttccatagc atagccactc agaagaaaaa ggttggagta atacccccta agaagttcat cacaagatta cggaaagaaa atgagctttt tgacaactac atgcaacaag atgcccatga attcttaaat tacctactaa atacaattgc tgatatttta caagaagaga gaaagcagga aaaacaaaat ggtcgtttac ctaatggtaa tattgataat gaaaataata acagcacacc agacccaacg tgggttgatg agatttttca gggaacatta actaatgaaa ccagatgtct tacttgtgaa actataagca gcaaagatga agatttttta gacctttctg ttgacgtgga acaaaataca tcaattactc actgcttaag gggtttcagc aacacagaaa ctctgtgcag tgaatacaag tattactgtg aagagtgtcg cagcaaacag gaagcacaca aacggatgaa agttaaaaaa ctgcccatga ttctagctct acacctgaag agatttaaat atatggatca acttcatcga tatacaaaac tctcttaccg ggtagttttt cctttagaac ttcgtctgtt taacacttca ggtgatgcca ccaatccaga cagaatgtac gaccttgttg ctgttgtggt tcactgtgga agtggtccca atcgaggcca ttatattgca atagttaaga gtcatgattt ttggttgttg tttgatgacg acattgtaga aaaaatagat gcacaagcta ttgaagaatt ctacgggttg acatcagata tctcaaagaa ctctgagtct ggttacatcc ttttctatca gtctcgggac tga. It is sometimes possible for the material contained within the vial of "USP12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
