Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FUS cdna clone

FUS cDNA Clone

Gene Names
FUS; TLS; ALS6; ETM4; FUS1; POMP75; HNRNPP2
Synonyms
FUS; FUS cDNA Clone; FUS cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcaaacgattatacccaacaagcaacccaaagctatggggcctaccccacccagcccgggcagggctattcccagcagagcagtcagccctacggacagcagagttacagtggttatagccagtccacggacacttcaggctatggccagagcagctattcttcttatggccagagccagaacacaggctatggaactcagtcaactccccagggatatggctcgactggcggctatggcagtagccagagctcccaatcgtcttacgggcagcagtcctcctatcctggctatggccagcagccagctcccagcagcacctcgggaagttacggtagcagttctcagagcagcagctatgggcagccccagagtgggagctacagccagcagcctagctatggtggacagcagcaaagctatggacagcagcaaagctataatccccctcagggctatggacagcagaaccagtacaacagcagcagtggtggtggaggtggaggtggaggtggaggtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggcttcaataaatttggtggccctcgggaccaaggatcacgtcatgactccgaacaggataattcagacaacaacaccatctttgtgcaaggcctgggtgagaatgttacaattgagtctgtggctgattacttcaagcagattggtattattaagacaaacaagaaaacgggacagcccatgattaatttgtacacagacagggaaactggcaagctgaagggagaggcaacggtctcttttgatgacccaccttcagctaaagcagctattgactggtttgatggtaaagaattctccggaaatcctatcaaggtctcatttgctactcgccgggcagactttaatcggggtggtggcaatggtcgtggaggccgagggcgaggaggacccatgggccgtggaggctatggaggtggtggcagtggtggtggtggccgaggaggatttcccagtggaggtggtggcggtggaggacagcagcgagctggtgactggaagtgtcctaatcccacctgtgagaatatgaacttctcttggaggaatgaatgcaaccagtgtaaggcccctaaaccagatggcccaggagggggaccaggtggctctcacatggggggtaactacggggatgatcgtcgtggtggcagaggaggctatgatcgaggcggctaccggggccgcggcggggaccgtggaggcttccgagggggccggggtggtggggacagaggtggctttggccctggcaagatggattccaggggtgagcacagacaggatcgcagggagaggccgtattaa
Sequence Length
1581
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,355 Da
NCBI Official Full Name
Homo sapiens fusion (involved in t(12;16) in malignant liposarcoma), mRNA
NCBI Official Synonym Full Names
FUS RNA binding protein
NCBI Official Symbol
FUS
NCBI Official Synonym Symbols
TLS; ALS6; ETM4; FUS1; POMP75; HNRNPP2
NCBI Protein Information
RNA-binding protein FUS
UniProt Protein Name
RNA-binding protein FUS
Protein Family
UniProt Gene Name
FUS
UniProt Synonym Gene Names
TLS
UniProt Entry Name
FUS_HUMAN

NCBI Description

This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6. [provided by RefSeq, Sep 2009]

Uniprot Description

hnRNP P2: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single- stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity. Component of nuclear riboprotein complexes. Interacts with ILF3, TDRD3 and SF1. Interacts through its C-terminus with SFRS13A. Interacts with OTUB1 and SARNP. Ubiquitous. Belongs to the RRM TET family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; RNA-binding; Nuclear receptor co-regulator; DNA-binding; Oncoprotein

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding; RNA binding; transcription coactivator activity

Biological Process: nuclear mRNA splicing, via spliceosome

Disease: Amyotrophic Lateral Sclerosis 6, With Or Without Frontotemporal Dementia; Tremor, Hereditary Essential, 4

Research Articles on FUS

Similar Products

Product Notes

The FUS fus (Catalog #AAA1277433) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcaa acgattatac ccaacaagca acccaaagct atggggccta ccccacccag cccgggcagg gctattccca gcagagcagt cagccctacg gacagcagag ttacagtggt tatagccagt ccacggacac ttcaggctat ggccagagca gctattcttc ttatggccag agccagaaca caggctatgg aactcagtca actccccagg gatatggctc gactggcggc tatggcagta gccagagctc ccaatcgtct tacgggcagc agtcctccta tcctggctat ggccagcagc cagctcccag cagcacctcg ggaagttacg gtagcagttc tcagagcagc agctatgggc agccccagag tgggagctac agccagcagc ctagctatgg tggacagcag caaagctatg gacagcagca aagctataat ccccctcagg gctatggaca gcagaaccag tacaacagca gcagtggtgg tggaggtgga ggtggaggtg gaggtaacta tggccaagat caatcctcca tgagtagtgg tggtggcagt ggtggcggtt atggcaatca agaccagagt ggtggaggtg gcagcggtgg ctatggacag caggaccgtg gaggccgcgg caggggtggc agtggtggcg gcggcggcgg cggcggtggt ggttacaacc gcagcagtgg tggctatgaa cccagaggtc gtggaggtgg ccgtggaggc agaggtggca tgggcggaag tgaccgtggt ggcttcaata aatttggtgg ccctcgggac caaggatcac gtcatgactc cgaacaggat aattcagaca acaacaccat ctttgtgcaa ggcctgggtg agaatgttac aattgagtct gtggctgatt acttcaagca gattggtatt attaagacaa acaagaaaac gggacagccc atgattaatt tgtacacaga cagggaaact ggcaagctga agggagaggc aacggtctct tttgatgacc caccttcagc taaagcagct attgactggt ttgatggtaa agaattctcc ggaaatccta tcaaggtctc atttgctact cgccgggcag actttaatcg gggtggtggc aatggtcgtg gaggccgagg gcgaggagga cccatgggcc gtggaggcta tggaggtggt ggcagtggtg gtggtggccg aggaggattt cccagtggag gtggtggcgg tggaggacag cagcgagctg gtgactggaa gtgtcctaat cccacctgtg agaatatgaa cttctcttgg aggaatgaat gcaaccagtg taaggcccct aaaccagatg gcccaggagg gggaccaggt ggctctcaca tggggggtaa ctacggggat gatcgtcgtg gtggcagagg aggctatgat cgaggcggct accggggccg cggcggggac cgtggaggct tccgaggggg ccggggtggt ggggacagag gtggctttgg ccctggcaag atggattcca ggggtgagca cagacaggat cgcagggaga ggccgtatta a. It is sometimes possible for the material contained within the vial of "FUS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.