TRAF3IP1 cdna clone

TRAF3IP1 cDNA Clone

Gene Names

TRAF3IP1; IFT54; MIPT3; SLSN9; MIP-T3

Synonyms

TRAF3IP1; TRAF3IP1 cDNA Clone; TRAF3IP1 cdna clone

Ordering
Cat. Num. AAA1277369 For Research Use Only!

Sequence

atgaacgcggcggtggtgaggcggacgcaggaggcgctggggaaagtgattcggaggccgccgctgacagagaagctgctgagcaagcccccgttccgctacctgcacgacatcatcacggaggtgattagaatgactggtttcatgaagggcctctacacagacgccgagatgaagtctgataatgtgaaggataaagatgcaaaaattagcttcctacaaaaggccatagacgtggttgtaatggtgtcgggagagccactgttggccaaaccagcccgaatcgtggcggggcatgagcctgaaagaacaaacgagctgctccagataattggaaaatgctgtctcaacaagctctctagtgacgatgcggtgcggagggttttagctggagagaagggagaagtgaaaggccgggcctcactgacctcaagatctcaggaattggataataagaatgtgcgagaagaagagtccagagttcacaaaaatacagaggatagaggagacgctgaaataaaagagagaagtacaagcagagatcgaaaacagaaggaagaattgaaagaagaccgcaagccaagagaaaaggacaaggacaaggagaaggccaaggagaatggcggaaacagacacagagaaggggagagagagagagccaaagcccgggccaggccagacagcgagcgacagaaagacagaggcaacagggagcgggacagagactccgagcgcaagaaggagacagagagaaagagtgagggggggaaagagaaggagagactgagagacagggaccgagagcgcgaccgggacaaagggaaggacagggacagacggagagtgaaaaacggggagcactcctgggacctggacagggagaagaacagagagcatgacaaacccgagaaaaagtcagcaagctcaggggagatgtctaaaaagttatcagatggaacttttaaagactccaaggctgaaacagagactgagatttccactagagcttccaagtcattgacaacaaaaacatcaaaacggcgatccaaaaattcagtggaaggtgactccaccagtgatgcagaaggagatgctggacctgctggccaagataagtctgaggtgccagagactccagaaattcctaatgagctttcatccaacatcagaagaattcctcggcctgggagtgcaagaccagcccctccccgggtcaaacggcaagacagcatggaggcgctacaaatggataggtcagggagtggtaaaaccgtttcaaatgtgattacagagtcacacaattctgacaatgaagaggatgatcaatttgtggtggaagctgcccctcagctctctgaaatgtcagaaattgaaatggtaacagcagtggaactagaagaagaggagaagcatggtggacttgtgaaaaaaattttggagacgaagaaagattatgagaaattgcagcagtcacccaaacctggggagaaggagcgatctctctttgagtcggcatggaagaaggagaaggacatcgtttccaaggagatagagaagctccgcacgtccatccagaccctgtgcaagagcgcacttcccctggggaagatcatggactacatccaggaagacgtggatgccatgcagaatgagctgcagatgtggcacagcgagaacaggcagcacgccgaggccctgcagcaggagcagaggatcacagactgtgccgtggagcccttaaaggctgagctcgcggagctggagcagctgatcaaagaccagcaagacaagatctgtgctgtgaaggccaacatcctcaagaatgaagaaaaaatccagaaaatggtatatagtatcaatttgacttcgagaaggtga

Sequence Length

1878

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

37590615

NCBI GeneID

26146

Molecular Weight

71,529 Da

NCBI Official Full Name

Homo sapiens TNF receptor-associated factor 3 interacting protein 1, mRNA

NCBI Official Synonym Full Names

TRAF3 interacting protein 1

NCBI Official Symbol

TRAF3IP1

NCBI Official Synonym Symbols

IFT54; MIPT3; SLSN9; MIP-T3

NCBI Protein Information

TRAF3-interacting protein 1

UniProt Protein Name

TRAF3-interacting protein 1

Protein Family

TRAF3-interacting protein

UniProt Gene Name

TRAF3IP1

UniProt Synonym Gene Names

IFT54; MIPT3; MIP-T3

UniProt Entry Name

MIPT3_HUMAN

Uniprot Description

TRAF3IP1: Plays an inhibitory role on IL13 signaling by binding to IL13RA1. Involved in suppression of IL13-induced STAT6 phosphorylation, transcriptional activity and DNA-binding. Recruits TRAF3 and DISC1 to the microtubules. Belongs to the TRAF3IP1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Microtubule-binding

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: centrosome

Molecular Function: protein binding

Biological Process: cilium biogenesis; intraflagellar transport; kidney development; morphogenesis of a polarized epithelium; negative regulation of defense response to virus; negative regulation of interferon type I production; negative regulation of protein amino acid phosphorylation; negative regulation of protein complex assembly

Disease: Senior-loken Syndrome 9

Research Articles on TRAF3IP1

1. Mutations in TRAF3IP1 are identified in patients with nephronophthisis and retinal degeneration. The identified mutations result in mild ciliary defects in patients and reveal a role of IFT54 as a negative regulator of microtubule stability via MAP4.

Similar Products

Product Notes

The TRAF3IP1 traf3ip1 (Catalog #AAA1277369) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgcgg cggtggtgag gcggacgcag gaggcgctgg ggaaagtgat tcggaggccg ccgctgacag agaagctgct gagcaagccc ccgttccgct acctgcacga catcatcacg gaggtgatta gaatgactgg tttcatgaag ggcctctaca cagacgccga gatgaagtct gataatgtga aggataaaga tgcaaaaatt agcttcctac aaaaggccat agacgtggtt gtaatggtgt cgggagagcc actgttggcc aaaccagccc gaatcgtggc ggggcatgag cctgaaagaa caaacgagct gctccagata attggaaaat gctgtctcaa caagctctct agtgacgatg cggtgcggag ggttttagct ggagagaagg gagaagtgaa aggccgggcc tcactgacct caagatctca ggaattggat aataagaatg tgcgagaaga agagtccaga gttcacaaaa atacagagga tagaggagac gctgaaataa aagagagaag tacaagcaga gatcgaaaac agaaggaaga attgaaagaa gaccgcaagc caagagaaaa ggacaaggac aaggagaagg ccaaggagaa tggcggaaac agacacagag aaggggagag agagagagcc aaagcccggg ccaggccaga cagcgagcga cagaaagaca gaggcaacag ggagcgggac agagactccg agcgcaagaa ggagacagag agaaagagtg agggggggaa agagaaggag agactgagag acagggaccg agagcgcgac cgggacaaag ggaaggacag ggacagacgg agagtgaaaa acggggagca ctcctgggac ctggacaggg agaagaacag agagcatgac aaacccgaga aaaagtcagc aagctcaggg gagatgtcta aaaagttatc agatggaact tttaaagact ccaaggctga aacagagact gagatttcca ctagagcttc caagtcattg acaacaaaaa catcaaaacg gcgatccaaa aattcagtgg aaggtgactc caccagtgat gcagaaggag atgctggacc tgctggccaa gataagtctg aggtgccaga gactccagaa attcctaatg agctttcatc caacatcaga agaattcctc ggcctgggag tgcaagacca gcccctcccc gggtcaaacg gcaagacagc atggaggcgc tacaaatgga taggtcaggg agtggtaaaa ccgtttcaaa tgtgattaca gagtcacaca attctgacaa tgaagaggat gatcaatttg tggtggaagc tgcccctcag ctctctgaaa tgtcagaaat tgaaatggta acagcagtgg aactagaaga agaggagaag catggtggac ttgtgaaaaa aattttggag acgaagaaag attatgagaa attgcagcag tcacccaaac ctggggagaa ggagcgatct ctctttgagt cggcatggaa gaaggagaag gacatcgttt ccaaggagat agagaagctc cgcacgtcca tccagaccct gtgcaagagc gcacttcccc tggggaagat catggactac atccaggaag acgtggatgc catgcagaat gagctgcaga tgtggcacag cgagaacagg cagcacgccg aggccctgca gcaggagcag aggatcacag actgtgccgt ggagccctta aaggctgagc tcgcggagct ggagcagctg atcaaagacc agcaagacaa gatctgtgct gtgaaggcca acatcctcaa gaatgaagaa aaaatccaga aaatggtata tagtatcaat ttgacttcga gaaggtga. It is sometimes possible for the material contained within the vial of "TRAF3IP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

TRAF3IP1 cdna clone