Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASGRF1 cdna clone

RASGRF1 cDNA Clone

Gene Names
RASGRF1; GNRP; GRF1; CDC25; GRF55; CDC25L; H-GRF55; PP13187; ras-GRF1
Synonyms
RASGRF1; RASGRF1 cDNA Clone; RASGRF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagaaggggatccggctgaatgatggccacgtcgcgtccctgggactgctggcgcgcaaggacggcacgcgcaaaggctacctgagcaagcggagttcggacaacacaaaatggcaaaccaagtggttcgcgctgctgcagaacctgctcttctacttcgagagcgactcgagctcgcggccctcggggctttacctgctggagggctgcgtctgcgaccgcgcgccctcccccaagccggcgctgtcggccaaggagccgctggagaaacagcattacttcacggtgaacttcagccatgagaaccagaaagccttggagctgaggacagaggacgcaaaagattgtgacgaatgggtggcagccattgcacatgccagctacaggaccctcgccacagagcatgaggcattaatgcagaaatacctgcacctgctgcagatcgtggagacagagaagaccgtggccaagcagcttcggcagcagatcgaggatggggagatcgagatcgagcggctgaaggcagagatcacatccctgctcaaggacaatgagcgcatccagtccacccagactgtcgcccccaacgatgaagacagcgacatcaagaaaattaagaaggtgcagagcttcctgcggggctggctgtgccggcggaagtggaagaccatcatccaggactacatccggtcaccccatgctgacagcatgcgcaagaggaaccaggtggtgttcagcatgctggaggctgaggctgagtacgtgcagcagctgcacatccttgtcaacaatttcctgcgcccgctgcggatggccgccagctccaagaagcctcccatcacacacgacgacgtcagcagcatcttcctgaacagcgaaaccatcatgtttttacatcagatcttttaccaaggcctgaaggcccgcatctccagctggcccacgctggtcctggctgacctatttgacatcctgctgcccatgctcaacatctaccaagagttcgtccgcaaccaccagtacagcctgcagatcctggcccactgcaagcagaaccgtgacttcgacaagctgctgaagcactacgaggccaagcctgactgcgaggagaggacgctggagaccttcctcacctaccccatgttccagatccccaggtacatcctgaccctccatgagctcctggcccacacgcctcatgagcacgttgagcgcaacagcctggactacgccaagtccaaactggaggagctgtccagaataatgcacgatgaagtaagtgagacggagaacatccggaaaaacctggccatcgagcgcatgatcatcgaaggctgtgagatcctcctggacaccagccagacctttgtgagacaaggttccctcattcaggtgcccatgtctgaaaagggcaagatcaccagggggcgcctggggtctctctccctaaagaaagagggcgagcgacagtgcttcctgttttctaagcatctgattatctgtaccagaggctctggagggaagcttcacttgaccaagaatggagtcatatccctcattgactgcactttattggaggagccagaaagcacggaggaggaagccaaaggatccggccaagacatagatcacttggattttaaaatcggggtggagccaaaggattccccgccctttacagtcatcctagtggcctcgtccagacaggagaaggcagcgtggaccagtgacatcagccagtgtgtggataacatccgatgcaatgggctcatgatgaacgcatttgaagaaaattccaaggtcactgtgccgcagatgatcaagtccgacgcctccttatattgtgatgatgttgacattcgcttcagcaaaaccatgaactcctgcaaagtgctgcagatccgctacgccagtgtggagcggctgctggagaggctgacggacctgcgcttcctgagcatcgacttcctcaacaccttcctgcactcctaccgcgtcttcaccaccgccatcgtggtcctggacaagctcattaccatctacaagaagcctatcagtgccattcctgccaggtcgctggagctcctgtttgccagtggccagaacaataagctcctgtacggtgaaccccccaagtccccgcgcgccacccgcaagttctcctcgccgccacctctgtccatcaccaagacatcgtcaccgagccgccggcggaagctctccctgaacatccccatcatcactggcggcaaggccctggacctggccgccctcagctgcaactccaatggctacaccagcatgtactcggccatgtcacccttcagcaaggccacgctggacaccagcaagctctatgtgtccagcagcttcaccaacaagattccagatgagggcgatacgacccctgagaagcccgaagacccttcagcgctcagcaagcagagctcagaagtctccatgagagaggagtcagatattgatcaaaaccagagtgatgatggtgatactgaaacatcaccaactaaatctccaacaacacccaaatcagtcaaaaacaaaaattcttcagagttcccactcttttcctataacaatggagtcgtcatgacctcctgtcgtgaactggacaataaccgcagtgccttgtcggccgcctctgcctttgccatagcaaccgccggggccaacgagggcaccccaaacaaggagaagtaccggaggatgtccttagccagtgcagggtttcccccagaccagaggaatggagacaaggagtttgtgatccgcagagcagccaccaatcgtgtcttgaacgtgctccgccactgggtgtccaagcactctcaggactttgagaccaacgatgagctcaaatgcaaggtgatcggcttcctggaagaagtcatgcacgacccggagctcctgacccaggagcggaaggctgcagccaacatcatcaggactctgacccaggaggacccaggtgacaaccagatcacgctggaggagatcacgcagatggctgaaggcgtgaaggctgagccctttgaaaaccactcagccctggagatcgcggagcagctgaccctgctagatcacctcgtcttcaagaagattccttatgaggagttcttcggacaaggatggatgaaactggaaaagaatgaaaggaccccttatatcatgaaaaccactaagcacttcaatgacatcagtaacttgattgcttcagaaatcatccgcaacgaggacatcaacgccagggtgagcgccatcgagaagtgggtggccgtagctgacatatgccgctgcctccacaactacaatgccgtactggagatcacctcgtccatgaaccgcagtgcaatcttccggctcaaaaagacgtggctcaaagtctctaagcaggtgcgggcaggaggctggcaccactgcctccctggggctggattggggctggggcaggaagacccgtgggctggccactgggcatccacaagtgggcaaaggactgggctgaggtctaacactcccaggtaa
Sequence Length
3546
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
143,218 Da
NCBI Official Full Name
Homo sapiens Ras protein-specific guanine nucleotide-releasing factor 1, mRNA
NCBI Official Synonym Full Names
Ras protein specific guanine nucleotide releasing factor 1
NCBI Official Symbol
RASGRF1
NCBI Official Synonym Symbols
GNRP; GRF1; CDC25; GRF55; CDC25L; H-GRF55; PP13187; ras-GRF1
NCBI Protein Information
ras-specific guanine nucleotide-releasing factor 1
UniProt Protein Name
Ras-specific guanine nucleotide-releasing factor 1
UniProt Gene Name
RASGRF1
UniProt Synonym Gene Names
CDC25; GNRP; GRF1; Ras-GRF1; GNRP
UniProt Entry Name
RGRF1_HUMAN

NCBI Description

The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]

Uniprot Description

RASGRF1: a guanine nucleotide exchange factor (GEF). Stimulates the dissociation of GDP from RAS protein. Activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit in the mouse brain,. The signaling pathway mediated by this protein may be important for long-term memory. Two alternatively spliced variants have been reported.

Protein type: GEFs; GEFs, Ras

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: cytosol; growth cone; plasma membrane

Molecular Function: guanyl-nucleotide exchange factor activity; Ras guanyl-nucleotide exchange factor activity

Biological Process: MAPKKK cascade; neurite development; positive regulation of GTPase activity; positive regulation of Ras protein signal transduction; regulation of Rac protein signal transduction; regulation of Ras protein signal transduction; regulation of synaptic plasticity; signal transduction

Research Articles on RASGRF1

Similar Products

Product Notes

The RASGRF1 rasgrf1 (Catalog #AAA1277366) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagaagg ggatccggct gaatgatggc cacgtcgcgt ccctgggact gctggcgcgc aaggacggca cgcgcaaagg ctacctgagc aagcggagtt cggacaacac aaaatggcaa accaagtggt tcgcgctgct gcagaacctg ctcttctact tcgagagcga ctcgagctcg cggccctcgg ggctttacct gctggagggc tgcgtctgcg accgcgcgcc ctcccccaag ccggcgctgt cggccaagga gccgctggag aaacagcatt acttcacggt gaacttcagc catgagaacc agaaagcctt ggagctgagg acagaggacg caaaagattg tgacgaatgg gtggcagcca ttgcacatgc cagctacagg accctcgcca cagagcatga ggcattaatg cagaaatacc tgcacctgct gcagatcgtg gagacagaga agaccgtggc caagcagctt cggcagcaga tcgaggatgg ggagatcgag atcgagcggc tgaaggcaga gatcacatcc ctgctcaagg acaatgagcg catccagtcc acccagactg tcgcccccaa cgatgaagac agcgacatca agaaaattaa gaaggtgcag agcttcctgc ggggctggct gtgccggcgg aagtggaaga ccatcatcca ggactacatc cggtcacccc atgctgacag catgcgcaag aggaaccagg tggtgttcag catgctggag gctgaggctg agtacgtgca gcagctgcac atccttgtca acaatttcct gcgcccgctg cggatggccg ccagctccaa gaagcctccc atcacacacg acgacgtcag cagcatcttc ctgaacagcg aaaccatcat gtttttacat cagatctttt accaaggcct gaaggcccgc atctccagct ggcccacgct ggtcctggct gacctatttg acatcctgct gcccatgctc aacatctacc aagagttcgt ccgcaaccac cagtacagcc tgcagatcct ggcccactgc aagcagaacc gtgacttcga caagctgctg aagcactacg aggccaagcc tgactgcgag gagaggacgc tggagacctt cctcacctac cccatgttcc agatccccag gtacatcctg accctccatg agctcctggc ccacacgcct catgagcacg ttgagcgcaa cagcctggac tacgccaagt ccaaactgga ggagctgtcc agaataatgc acgatgaagt aagtgagacg gagaacatcc ggaaaaacct ggccatcgag cgcatgatca tcgaaggctg tgagatcctc ctggacacca gccagacctt tgtgagacaa ggttccctca ttcaggtgcc catgtctgaa aagggcaaga tcaccagggg gcgcctgggg tctctctccc taaagaaaga gggcgagcga cagtgcttcc tgttttctaa gcatctgatt atctgtacca gaggctctgg agggaagctt cacttgacca agaatggagt catatccctc attgactgca ctttattgga ggagccagaa agcacggagg aggaagccaa aggatccggc caagacatag atcacttgga ttttaaaatc ggggtggagc caaaggattc cccgcccttt acagtcatcc tagtggcctc gtccagacag gagaaggcag cgtggaccag tgacatcagc cagtgtgtgg ataacatccg atgcaatggg ctcatgatga acgcatttga agaaaattcc aaggtcactg tgccgcagat gatcaagtcc gacgcctcct tatattgtga tgatgttgac attcgcttca gcaaaaccat gaactcctgc aaagtgctgc agatccgcta cgccagtgtg gagcggctgc tggagaggct gacggacctg cgcttcctga gcatcgactt cctcaacacc ttcctgcact cctaccgcgt cttcaccacc gccatcgtgg tcctggacaa gctcattacc atctacaaga agcctatcag tgccattcct gccaggtcgc tggagctcct gtttgccagt ggccagaaca ataagctcct gtacggtgaa ccccccaagt ccccgcgcgc cacccgcaag ttctcctcgc cgccacctct gtccatcacc aagacatcgt caccgagccg ccggcggaag ctctccctga acatccccat catcactggc ggcaaggccc tggacctggc cgccctcagc tgcaactcca atggctacac cagcatgtac tcggccatgt cacccttcag caaggccacg ctggacacca gcaagctcta tgtgtccagc agcttcacca acaagattcc agatgagggc gatacgaccc ctgagaagcc cgaagaccct tcagcgctca gcaagcagag ctcagaagtc tccatgagag aggagtcaga tattgatcaa aaccagagtg atgatggtga tactgaaaca tcaccaacta aatctccaac aacacccaaa tcagtcaaaa acaaaaattc ttcagagttc ccactctttt cctataacaa tggagtcgtc atgacctcct gtcgtgaact ggacaataac cgcagtgcct tgtcggccgc ctctgccttt gccatagcaa ccgccggggc caacgagggc accccaaaca aggagaagta ccggaggatg tccttagcca gtgcagggtt tcccccagac cagaggaatg gagacaagga gtttgtgatc cgcagagcag ccaccaatcg tgtcttgaac gtgctccgcc actgggtgtc caagcactct caggactttg agaccaacga tgagctcaaa tgcaaggtga tcggcttcct ggaagaagtc atgcacgacc cggagctcct gacccaggag cggaaggctg cagccaacat catcaggact ctgacccagg aggacccagg tgacaaccag atcacgctgg aggagatcac gcagatggct gaaggcgtga aggctgagcc ctttgaaaac cactcagccc tggagatcgc ggagcagctg accctgctag atcacctcgt cttcaagaag attccttatg aggagttctt cggacaagga tggatgaaac tggaaaagaa tgaaaggacc ccttatatca tgaaaaccac taagcacttc aatgacatca gtaacttgat tgcttcagaa atcatccgca acgaggacat caacgccagg gtgagcgcca tcgagaagtg ggtggccgta gctgacatat gccgctgcct ccacaactac aatgccgtac tggagatcac ctcgtccatg aaccgcagtg caatcttccg gctcaaaaag acgtggctca aagtctctaa gcaggtgcgg gcaggaggct ggcaccactg cctccctggg gctggattgg ggctggggca ggaagacccg tgggctggcc actgggcatc cacaagtggg caaaggactg ggctgaggtc taacactccc aggtaa. It is sometimes possible for the material contained within the vial of "RASGRF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.