CPXM1 cdna clone
CPXM1 cDNA Clone
Gene Names
CPXM1; CPX1; CPXM
Synonyms
CPXM1; CPXM1 cDNA Clone; CPXM1 cdna clone
Sequence
atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacgggacctcagaacagcatgtccggattcgagtcatcaagaagaaaaaggtcattatgaagaagcggaagaagctaactctaactcgccccaccccactggtgactgccgggccccttgtgacccccactccagcagggaccctcgaccccgctgagaaacaagaaacaggctgtcctcctttgggtctggagtccctgcgagtttcagatagccggcttgaggcatccagcagccagtcctttggtcttggaccacaccgaggacggctcaacattcagtcaggcctggaggacggcgatctatatgatggagcctggtgtgctgaggagcaggacgccgatccatggtttcaggtggacgctgggcaccccacccgcttctcgggtgttatcacacagggcaggaactctgtctggaggtatgactgggtcacatcatacaaggtccagttcagcaatgacagtcggacctggtggggaagtaggaaccacagcagtgggatggacgcagtatttcctgccaattcagacccagaaactccagtgctgaacctcctgccggagccccaggtggcccgcttcattcgcctgctgccccagacctggctccagggaggcgcgccttgcctccgggcagagatcctggcctgcccagtctcagaccccaatgacctattccttgaggcccctgcgtcgggatcctctgaccctctagactttcagcatcacaattacaaggccatgaggaaggtcagatataacccctatgacctgggaaggagggcccacccatctcaggtccccttcccaccttcccaccggggcacaacctgctgtgactgcgcttgtatgcccctgctgcctcctgatgtctcagccttctctcctgtggacccctaa
Sequence Length
1071
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
81,668 Da
NCBI Official Full Name
Homo sapiens carboxypeptidase X (M14 family), member 1, mRNA
NCBI Official Synonym Full Names
carboxypeptidase X, M14 family member 1
NCBI Official Symbol
CPXM1
NCBI Official Synonym Symbols
CPX1; CPXM
NCBI Protein Information
probable carboxypeptidase X1
UniProt Protein Name
Probable carboxypeptidase X1
Protein Family
UniProt Gene Name
CPXM1
UniProt Synonym Gene Names
CPX1; CPXM
UniProt Entry Name
CPXM1_HUMAN
NCBI Description
This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Uniprot Description
CPXM1: May be involved in cell-cell interactions. No carboxypeptidase activity was found yet. Belongs to the peptidase M14 family.
Protein type: EC 3.4.17.-; Secreted; Protease; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 20p13
Cellular Component: extracellular space
Molecular Function: metallocarboxypeptidase activity; serine carboxypeptidase activity
Biological Process: peptide metabolic process; protein processing
Research Articles on CPXM1
Similar Products
Product Notes
The CPXM1 cpxm1 (Catalog #AAA1277363) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggggc tcctgctcgc cctggccgcc ttcgcgccgg ccgtcggccc ggctctgggg gcgcccagga actcggtgct gggcctcgcg cagcccggga ccaccaaggt cccaggctcg accccggccc tgcatagcag cccggcacag ccgccggcgg agacagctaa cgggacctca gaacagcatg tccggattcg agtcatcaag aagaaaaagg tcattatgaa gaagcggaag aagctaactc taactcgccc caccccactg gtgactgccg ggccccttgt gacccccact ccagcaggga ccctcgaccc cgctgagaaa caagaaacag gctgtcctcc tttgggtctg gagtccctgc gagtttcaga tagccggctt gaggcatcca gcagccagtc ctttggtctt ggaccacacc gaggacggct caacattcag tcaggcctgg aggacggcga tctatatgat ggagcctggt gtgctgagga gcaggacgcc gatccatggt ttcaggtgga cgctgggcac cccacccgct tctcgggtgt tatcacacag ggcaggaact ctgtctggag gtatgactgg gtcacatcat acaaggtcca gttcagcaat gacagtcgga cctggtgggg aagtaggaac cacagcagtg ggatggacgc agtatttcct gccaattcag acccagaaac tccagtgctg aacctcctgc cggagcccca ggtggcccgc ttcattcgcc tgctgcccca gacctggctc cagggaggcg cgccttgcct ccgggcagag atcctggcct gcccagtctc agaccccaat gacctattcc ttgaggcccc tgcgtcggga tcctctgacc ctctagactt tcagcatcac aattacaagg ccatgaggaa ggtcagatat aacccctatg acctgggaag gagggcccac ccatctcagg tccccttccc accttcccac cggggcacaa cctgctgtga ctgcgcttgt atgcccctgc tgcctcctga tgtctcagcc ttctctcctg tggaccccta a. It is sometimes possible for the material contained within the vial of "CPXM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
