Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZMYND11 cdna clone

ZMYND11 cDNA Clone

Gene Names
ZMYND11; BS69; BRAM1; MRD30
Synonyms
ZMYND11; ZMYND11 cDNA Clone; ZMYND11 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgagtccacggtatgcaccctaaagagaccacccgtcagctgagcttagctgtgaaagatggtcttattgtcgaaactctaacagtgggctgcaaaggttcaaaagctggtattgaacaagaaggatattggttgccaggagatgagattgactgggaaacagaaaatcatgactggtattgttttgaatgccatttgcctggagaggtgttgatatgtgacctgtgttttcgtgtgtatcattccaagtgtttgtctgatgagttcaggcttagagacagcagtagtccctggcagtgcccagtttgcaggagcattaagaagaagaatacaaacaaacaggagatgggcacatacctcagattcattgtctcccgcatgaaggagagggctatagatcttaataaaaaggggaaggacaataaacacccgatgtacaggaggctggtgcactcagctgtggacgttcccaccattcaagagaaagtgaatgaagggaaataccgaagttatgaagagttcaaagctgatgcccaattgcttctccacaataccgtgattttctatggagacagtgagcaagctgacattgcgaggatgctatataaagacacatgtcatgagctggatgaactgcagctttgcaagaattgcttttacttgtcaaatgctcgtcctgacaactggttctgttatccttgtatacctaatcatgagctggtttgggctaaaatgaaaggttttgggttttggccagccaaagtcatgcagaaagaagacaatcaagtcgacgttcgcttctttggccaccaccaccagagggcctggattccttctgaaaacattcaagatatcacagtcaacattcatcggctgcacgtgaagcgcagtatgggttggaaaaaggcctgtgatgagctggagctgcatcagcgtttcctacgagaagggagattttggaaatctaagaatgaggaccgaggtgaggaagaggcagaatccagtatctcctccaccagtaatgagcagctaaaggtcactcaagaaccaagagcaaagaaaggacgacgtaatcaaagtgtggagcccaaaaaggaagaaccagagcctgaaacagaagcagtaagttctagccaggaaatacccacgatgcctcagcccatcgaaaaagtctccgtgtcaactcagacaaagaagttaagtgcctcttcaccaagaatgctgcatcggagcacccagaccacaaacgacggcgtgtgtcagagcatgtgccatgacaaatacaccaagatcttcaatgacttcaaagaccggatgaagtcggaccacaagcgggagacagagcgtgttgtccgagaagctctggagaagctgcgttctgaaatggaagaagaaaagagacaagctgtaaataaagctgtagccaacatgcagggtgagatggacagaaaatgtaagcaagtaaaggaaaagtgtaaggaagaatttgtagaagaaatcaagaagctggcaacacagcacaagcaactgatttctcagaccaagaagaagcagtgggtaaataccagtcttttttag
Sequence Length
1584
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,519 Da
NCBI Official Full Name
Homo sapiens zinc finger, MYND domain containing 11, mRNA
NCBI Official Synonym Full Names
zinc finger MYND-type containing 11
NCBI Official Symbol
ZMYND11
NCBI Official Synonym Symbols
BS69; BRAM1; MRD30
NCBI Protein Information
zinc finger MYND domain-containing protein 11
UniProt Protein Name
Zinc finger MYND domain-containing protein 11
UniProt Gene Name
ZMYND11
UniProt Synonym Gene Names
BRAM1; BS69
UniProt Entry Name
ZMY11_HUMAN

NCBI Description

The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

ZMYND11: Corepressor of transcription (Probable).

Protein type: Tumor suppressor; DNA-binding; Transcription regulation

Chromosomal Location of Human Ortholog: 10p14

Cellular Component: nucleoplasm; nucleus

Molecular Function: chromatin binding; histone binding; methylated histone residue binding; protein binding; transcription cofactor activity; transcription corepressor activity; zinc ion binding

Biological Process: cell proliferation; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of JNK cascade; negative regulation of transcription from RNA polymerase II promoter

Disease: Mental Retardation, Autosomal Dominant 30

Research Articles on ZMYND11

Similar Products

Product Notes

The ZMYND11 zmynd11 (Catalog #AAA1277219) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcgag tccacggtat gcaccctaaa gagaccaccc gtcagctgag cttagctgtg aaagatggtc ttattgtcga aactctaaca gtgggctgca aaggttcaaa agctggtatt gaacaagaag gatattggtt gccaggagat gagattgact gggaaacaga aaatcatgac tggtattgtt ttgaatgcca tttgcctgga gaggtgttga tatgtgacct gtgttttcgt gtgtatcatt ccaagtgttt gtctgatgag ttcaggctta gagacagcag tagtccctgg cagtgcccag tttgcaggag cattaagaag aagaatacaa acaaacagga gatgggcaca tacctcagat tcattgtctc ccgcatgaag gagagggcta tagatcttaa taaaaagggg aaggacaata aacacccgat gtacaggagg ctggtgcact cagctgtgga cgttcccacc attcaagaga aagtgaatga agggaaatac cgaagttatg aagagttcaa agctgatgcc caattgcttc tccacaatac cgtgattttc tatggagaca gtgagcaagc tgacattgcg aggatgctat ataaagacac atgtcatgag ctggatgaac tgcagctttg caagaattgc ttttacttgt caaatgctcg tcctgacaac tggttctgtt atccttgtat acctaatcat gagctggttt gggctaaaat gaaaggtttt gggttttggc cagccaaagt catgcagaaa gaagacaatc aagtcgacgt tcgcttcttt ggccaccacc accagagggc ctggattcct tctgaaaaca ttcaagatat cacagtcaac attcatcggc tgcacgtgaa gcgcagtatg ggttggaaaa aggcctgtga tgagctggag ctgcatcagc gtttcctacg agaagggaga ttttggaaat ctaagaatga ggaccgaggt gaggaagagg cagaatccag tatctcctcc accagtaatg agcagctaaa ggtcactcaa gaaccaagag caaagaaagg acgacgtaat caaagtgtgg agcccaaaaa ggaagaacca gagcctgaaa cagaagcagt aagttctagc caggaaatac ccacgatgcc tcagcccatc gaaaaagtct ccgtgtcaac tcagacaaag aagttaagtg cctcttcacc aagaatgctg catcggagca cccagaccac aaacgacggc gtgtgtcaga gcatgtgcca tgacaaatac accaagatct tcaatgactt caaagaccgg atgaagtcgg accacaagcg ggagacagag cgtgttgtcc gagaagctct ggagaagctg cgttctgaaa tggaagaaga aaagagacaa gctgtaaata aagctgtagc caacatgcag ggtgagatgg acagaaaatg taagcaagta aaggaaaagt gtaaggaaga atttgtagaa gaaatcaaga agctggcaac acagcacaag caactgattt ctcagaccaa gaagaagcag tgggtaaata ccagtctttt ttag. It is sometimes possible for the material contained within the vial of "ZMYND11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.