USMG5 cdna clone
USMG5 cDNA Clone
Gene Names
USMG5; DAPIT; HCVFTP2; bA792D24.4
Synonyms
USMG5; USMG5 cDNA Clone; USMG5 cdna clone
Sequence
atggcaggtccagaaagtgatgcgcaataccagttcactggtattaaaaaatatttcaactcttatactctcacaggtagaatgaactgtgtactggccacatatggaagcattgcattgattgtcttatatttcaagttaaggtccaaaaaaactccagctgtgaaagcaacataa
Sequence Length
177
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
6,458 Da
NCBI Official Full Name
Homo sapiens up-regulated during skeletal muscle growth 5 homolog (mouse), mRNA
NCBI Official Synonym Full Names
up-regulated during skeletal muscle growth 5 homolog (mouse)
NCBI Official Symbol
USMG5
NCBI Official Synonym Symbols
DAPIT; HCVFTP2; bA792D24.4
NCBI Protein Information
up-regulated during skeletal muscle growth protein 5
UniProt Protein Name
Up-regulated during skeletal muscle growth protein 5
Protein Family
UniProt Gene Name
USMG5
UniProt Synonym Gene Names
DAPIT; HCVFTP2
UniProt Entry Name
USMG5_HUMAN
Uniprot Description
USMG5: Plays a critical role in maintaining the ATP synthase population in mitochondria.
Protein type: Membrane protein, integral; Mitochondrial
Chromosomal Location of Human Ortholog: 10q24.33
Cellular Component: mitochondrial proton-transporting ATP synthase complex; mitochondrion
Research Articles on USMG5
Similar Products
Product Notes
The USMG5 usmg5 (Catalog #AAA1277071) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggtc cagaaagtga tgcgcaatac cagttcactg gtattaaaaa atatttcaac tcttatactc tcacaggtag aatgaactgt gtactggcca catatggaag cattgcattg attgtcttat atttcaagtt aaggtccaaa aaaactccag ctgtgaaagc aacataa. It is sometimes possible for the material contained within the vial of "USMG5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
