SLC25A45 cdna clone
SLC25A45 cDNA Clone
Synonyms
SLC25A45; SLC25A45 cDNA Clone; SLC25A45 cdna clone
Sequence
atgccggtggaggaatttgtggctggctggatctctggcgctctgggcttggtcctgggacacccgtttgacactgtaaagctcctgggcttcttcaagggaatgagcttccccattgccagcatagctgtggtcaactctgtcctgtttggggtctatagcaacaccctgctggtgctcacggccacctcccaccaggagcggcgggcccagccgcccagctacatgcacatcttcctagcgggctgcaccggggggttcctgcaggcctactgtctggctccttttgacctcatcaaagtccggctacaaaaccagacagagccaagggcccagccagggagccccccaccccggtaccaggggcccgtgcactgtgcagcctccatcttccgggaggaggggccccgggggctgttccgaggagcctgggccctgacgctgagggacacccccacggtggggatctacttcatcacctatgaagggctctgtcgccagtacacaccagaaggccagaatcccagctcagccacggtgctggtggcaggggggctttgcaggcattgcttcctgggtggcagccacgcccttagacgtgatcaagtcccggatgcagatggatggactgagacgcagagtgtaccaggggatgctggactgcatggtgagcagcatccggcaggaaggactgggagtcttcttccggggggtcaccatcaacagtgcccgcgcctttcccgtcaatgctgtcaccttcctcagctacgaatatctcctccgctggtggggatgagccctgcggcaatgccagcagctccccatcaggcccacggcctggaggccagtttgagattggaggccaggttgaaagcttgcaaatcagtgcaagaggctcagcccttcctaaccaaggtgcctcccacccgcgcagatctgggctgggcagacacctgtgggagccggaagccgggggcctgtgcagcctccctgtgtagctggccttga
Sequence Length
1008
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,027 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25, member 45, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 45
NCBI Official Symbol
SLC25A45
NCBI Protein Information
solute carrier family 25 member 45
UniProt Protein Name
Solute carrier family 25 member 45
Protein Family
UniProt Gene Name
SLC25A45
UniProt Entry Name
S2545_HUMAN
NCBI Description
SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Uniprot Description
SLC25A45: Belongs to the mitochondrial carrier family. 4 isoforms of the human protein are produced by alternative splicing
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 11q13.1
Molecular Function: structural constituent of ribosome
Biological Process: translation
Research Articles on SLC25A45
Similar Products
Product Notes
The SLC25A45 slc25a45 (Catalog #AAA1277014) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggtgg aggaatttgt ggctggctgg atctctggcg ctctgggctt ggtcctggga cacccgtttg acactgtaaa gctcctgggc ttcttcaagg gaatgagctt ccccattgcc agcatagctg tggtcaactc tgtcctgttt ggggtctata gcaacaccct gctggtgctc acggccacct cccaccagga gcggcgggcc cagccgccca gctacatgca catcttccta gcgggctgca ccggggggtt cctgcaggcc tactgtctgg ctccttttga cctcatcaaa gtccggctac aaaaccagac agagccaagg gcccagccag ggagcccccc accccggtac caggggcccg tgcactgtgc agcctccatc ttccgggagg aggggccccg ggggctgttc cgaggagcct gggccctgac gctgagggac acccccacgg tggggatcta cttcatcacc tatgaagggc tctgtcgcca gtacacacca gaaggccaga atcccagctc agccacggtg ctggtggcag gggggctttg caggcattgc ttcctgggtg gcagccacgc ccttagacgt gatcaagtcc cggatgcaga tggatggact gagacgcaga gtgtaccagg ggatgctgga ctgcatggtg agcagcatcc ggcaggaagg actgggagtc ttcttccggg gggtcaccat caacagtgcc cgcgcctttc ccgtcaatgc tgtcaccttc ctcagctacg aatatctcct ccgctggtgg ggatgagccc tgcggcaatg ccagcagctc cccatcaggc ccacggcctg gaggccagtt tgagattgga ggccaggttg aaagcttgca aatcagtgca agaggctcag cccttcctaa ccaaggtgcc tcccacccgc gcagatctgg gctgggcaga cacctgtggg agccggaagc cgggggcctg tgcagcctcc ctgtgtagct ggccttga. It is sometimes possible for the material contained within the vial of "SLC25A45, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
