Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CX3CL1 cdna clone

CX3CL1 cDNA Clone

Gene Names
CX3CL1; NTN; NTT; CXC3; CXC3C; SCYD1; ABCD-3; C3Xkine; fractalkine; neurotactin
Synonyms
CX3CL1; CX3CL1 cDNA Clone; CX3CL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctccgatatctctgtcgtggctgctccgcttggccaccttctgccatctgactgtcctgctggctggacagcaccacggtgtgacgaaatgcaacatcacgtgcagcaagatgacatcaaagatacctgtagctttgctcatccactatcaacagaaccaggcatcatgcggcaaacgcgcaatcatcttggagacgagacagcacaggctgttctgtgccgacccgaaggagcaatgggtcaaggacgcgatgcagcatctggaccgccaggctgctgccctaactcgaaatggcggcaccttcgagaagcagatcggcgaggtgaagcccaggaccacccctgccgccgggggaatggacgagtctgtggtcctggagcccgaagccacaggcgaaagcagtagcctggagccgactccttcttcccaggaagcacagagggccctggggacctccccagagctgccgacgggcgtgactggttcctcagggaccaggctccccccgacgccaaaggctcaggatggagggcctgtgggcacggagcttttccgagtgcctcccgtctccactgccgccacgtggcagagttctgctccccaccaacctgggcccagcctctgggctgaggcaaagacctctgaggccccgtccacccaggacccctccacccaggcctccactgcgtcctccccagccccagaggagaatgctccgtctgaaggccagcgtgtgtggggtcagggacagagccccaggccagagaactctctggagcgggaggagatgggtcccgtgccagcgcacacggatgccttccaggactgggggcctggcagcatggcccacgtctctgtggtccctgtctcctcagaagggacccccagcagggagccagtggcttcaggcagctggacccctaaggctgaggaacccatccatgccaccatggacccccagaggctgggcgtccttatcactcctgtccctgacgcccaggctgccacccggaggcaggcggtggggctgctggccttccttggcctcctcttctgcctgggggtggccatgttcacctaccagagcctccagggctgccctcgaaagatggcaggagagatggcggagggccttcgctacatcccccggagctgtggtagtaattcatatgtcctggtgcccgtgtga
Sequence Length
1194
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,203 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X3-C motif) ligand 1, mRNA
NCBI Official Synonym Full Names
C-X3-C motif chemokine ligand 1
NCBI Official Symbol
CX3CL1
NCBI Official Synonym Symbols
NTN; NTT; CXC3; CXC3C; SCYD1; ABCD-3; C3Xkine; fractalkine; neurotactin
NCBI Protein Information
fractalkine
UniProt Protein Name
Fractalkine
Protein Family
UniProt Gene Name
CX3CL1
UniProt Synonym Gene Names
FKN; NTT; SCYD1
UniProt Entry Name
X3CL1_HUMAN

Uniprot Description

CX3CL1: The soluble form is chemotactic for T-cells and monocytes, but not for neutrophils. The membrane-bound form promotes adhesion of those leukocytes to endothelial cells. May play a role in regulating leukocyte adhesion and migration processes at the endothelium. Binds to CX3CR1. Belongs to the intercrine delta family.

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 16q13

Cellular Component: cell surface; extracellular region; extracellular space; integral to membrane; plasma membrane

Molecular Function: CCR chemokine receptor binding; chemokine activity; CX3C chemokine receptor binding; integrin binding; protein binding; receptor binding

Biological Process: chemotaxis; cytokine and chemokine mediated signaling pathway; defense response; G-protein coupled receptor protein signaling pathway; immune response; integrin activation; leukocyte adhesive activation; leukocyte chemotaxis; leukocyte migration during inflammatory response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of calcium-independent cell-cell adhesion; positive regulation of GTPase activity; positive regulation of inflammatory response

Research Articles on CX3CL1

Similar Products

Product Notes

The CX3CL1 cx3cl1 (Catalog #AAA1276961) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccga tatctctgtc gtggctgctc cgcttggcca ccttctgcca tctgactgtc ctgctggctg gacagcacca cggtgtgacg aaatgcaaca tcacgtgcag caagatgaca tcaaagatac ctgtagcttt gctcatccac tatcaacaga accaggcatc atgcggcaaa cgcgcaatca tcttggagac gagacagcac aggctgttct gtgccgaccc gaaggagcaa tgggtcaagg acgcgatgca gcatctggac cgccaggctg ctgccctaac tcgaaatggc ggcaccttcg agaagcagat cggcgaggtg aagcccagga ccacccctgc cgccggggga atggacgagt ctgtggtcct ggagcccgaa gccacaggcg aaagcagtag cctggagccg actccttctt cccaggaagc acagagggcc ctggggacct ccccagagct gccgacgggc gtgactggtt cctcagggac caggctcccc ccgacgccaa aggctcagga tggagggcct gtgggcacgg agcttttccg agtgcctccc gtctccactg ccgccacgtg gcagagttct gctccccacc aacctgggcc cagcctctgg gctgaggcaa agacctctga ggccccgtcc acccaggacc cctccaccca ggcctccact gcgtcctccc cagccccaga ggagaatgct ccgtctgaag gccagcgtgt gtggggtcag ggacagagcc ccaggccaga gaactctctg gagcgggagg agatgggtcc cgtgccagcg cacacggatg ccttccagga ctgggggcct ggcagcatgg cccacgtctc tgtggtccct gtctcctcag aagggacccc cagcagggag ccagtggctt caggcagctg gacccctaag gctgaggaac ccatccatgc caccatggac ccccagaggc tgggcgtcct tatcactcct gtccctgacg cccaggctgc cacccggagg caggcggtgg ggctgctggc cttccttggc ctcctcttct gcctgggggt ggccatgttc acctaccaga gcctccaggg ctgccctcga aagatggcag gagagatggc ggagggcctt cgctacatcc cccggagctg tggtagtaat tcatatgtcc tggtgcccgt gtga. It is sometimes possible for the material contained within the vial of "CX3CL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.