Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC89 cdna clone

CCDC89 cDNA Clone

Synonyms
CCDC89; CCDC89 cDNA Clone; CCDC89 cdna clone
Ordering
For Research Use Only!
Sequence
atgagagcgcctatgctccagaaacagcaggctcccaggatggacaccccgccccctgaagaacgcttagagaagcaaaatgaaaaactgaacaaccaggaagaggagacggagtttaaggaactggacggtctgagggaagccttggcaaacctccggggactgtcagaggaggagaggagcgagaaggctatgcttcgctcccgcattgaagagcagtcccagctcatctgcatcctgaagcggaggtcagatgaggccctggagcgctgccagatcctagagctgctcaatgcagagctggaggagaagatgatgcaggaggctgagaagctcaaggcccagggtgagtacagtcggaaactagaggaacgctttatgaccctagcagccaaccacgagttgatgctccgcttcaaggatgaatacaagagtgagaacatcaagctgagggaggagaatgagaagctgaggctggagaatagcagcctcttcagccaggctctgaaggatgaggaggcgaaagtattacagctcacagtccggtgtgaggccctcactggggagctagaaacgctgaaggagaggtgtgctcaggatgcctgccaggcacaggcgcgcgagaaggagctgctggagctacagagccagcaggcctgcacccacaccaaggagacagaacagctgcgcagccagctgcagaccctcaagcagcagcaccagcaggctgtggagcagatagctaaggcagaggagacacacagcagcctgagccaggagctgcaggccaggctgcagaccgtcactagagagaaagaggagttgctgcagctgtccattgaaaggggcaaagtgcttcagaacaaacaggcagagatctgccagcttgaggaaaagttggagatagcaaatgaagacaggaagcatgcgctggagcggtttgagcaagaggcagtggctgtggacagcaacttgagagtcagggagcttcagcgcaaagtagatgggatccagaaggcctacgatgaactcaggctgcagtctgaagccttcaaaaagcacagcttggatcttttaagcaaggagagagaactcaatggcaaactccgccatctctctccatag
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,809 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 89, mRNA
NCBI Official Synonym Full Names
coiled-coil domain containing 89
NCBI Official Symbol
CCDC89
NCBI Protein Information
coiled-coil domain-containing protein 89
UniProt Protein Name
Coiled-coil domain-containing protein 89
UniProt Gene Name
CCDC89
UniProt Synonym Gene Names
BOIP
UniProt Entry Name
CCD89_HUMAN

Uniprot Description

CCDC89: Belongs to the CCDC89 family.

Chromosomal Location of Human Ortholog: 11q14.1

Similar Products

Product Notes

The CCDC89 ccdc89 (Catalog #AAA1276929) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagcgc ctatgctcca gaaacagcag gctcccagga tggacacccc gccccctgaa gaacgcttag agaagcaaaa tgaaaaactg aacaaccagg aagaggagac ggagtttaag gaactggacg gtctgaggga agccttggca aacctccggg gactgtcaga ggaggagagg agcgagaagg ctatgcttcg ctcccgcatt gaagagcagt cccagctcat ctgcatcctg aagcggaggt cagatgaggc cctggagcgc tgccagatcc tagagctgct caatgcagag ctggaggaga agatgatgca ggaggctgag aagctcaagg cccagggtga gtacagtcgg aaactagagg aacgctttat gaccctagca gccaaccacg agttgatgct ccgcttcaag gatgaataca agagtgagaa catcaagctg agggaggaga atgagaagct gaggctggag aatagcagcc tcttcagcca ggctctgaag gatgaggagg cgaaagtatt acagctcaca gtccggtgtg aggccctcac tggggagcta gaaacgctga aggagaggtg tgctcaggat gcctgccagg cacaggcgcg cgagaaggag ctgctggagc tacagagcca gcaggcctgc acccacacca aggagacaga acagctgcgc agccagctgc agaccctcaa gcagcagcac cagcaggctg tggagcagat agctaaggca gaggagacac acagcagcct gagccaggag ctgcaggcca ggctgcagac cgtcactaga gagaaagagg agttgctgca gctgtccatt gaaaggggca aagtgcttca gaacaaacag gcagagatct gccagcttga ggaaaagttg gagatagcaa atgaagacag gaagcatgcg ctggagcggt ttgagcaaga ggcagtggct gtggacagca acttgagagt cagggagctt cagcgcaaag tagatgggat ccagaaggcc tacgatgaac tcaggctgca gtctgaagcc ttcaaaaagc acagcttgga tcttttaagc aaggagagag aactcaatgg caaactccgc catctctctc catag. It is sometimes possible for the material contained within the vial of "CCDC89, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.