Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

RNF38 cdna clone

RNF38 cDNA Clone

Synonyms
RNF38; RNF38 cDNA Clone; RNF38 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgcgaccatgggagatgacatcaaataggcagcccccttcagttcgaccaagccaacatcacttctcaggggaacgatgcaacacacctgcacgcaacagaagaagtcctcctgtcaggcgccagagaggaagaagggatcgtctgtctcgacataattccattagtcaagatgaaaactatcaccatctcccttacgcacagcagcaagcaatagaggagcctcgagccttccaccctccgaatgtatctccccgtctgctacatcctgctgctcatccaccccagcagaatgcagtcatggttgacatacatgatcagctccatcaaggaacagtccctgtttcttacacagtaacaacagtggcaccacatgggattccactctgcacaggccagcacatccctgcttgtagtacacagcaggtcccaggatgctctgtggttttcagtggacagcacctccctgtctgtagtgtgcctcctccaatgcttcaggcatgttcagttcagcacttaccagtaccatatgctgcattcccaccccttatttctagtgatccatttcttatacatcctcctcacctttctccccatcatcctcctcatttgccaccaccaggccagtttgtccctttccaaacacagcaatcacgatcgcctctgcaaaggatagaaaatgaagtggaactcttaggagaacatcttccagtaggaggttttacttaccctccatcagcccaccccccaacattacctccatcagctcccttgcagttcttaacacatgatcctttgcatcaggaggtgtcctttggagtaccttatcctccatttatgcctcggaggcttacaggacgtagtagataccgatcccagcagccaataccacctcccccttatcatcccagcttactgccatatgtgttatcaatgcttccagtgccacctgcagtgggcccaactttcagctttgaattagatgtagaagatggagaagtagaaaattacgaggccctgttaaacctggcagagcgactgggagaggcaaagcctcgtggactgactaaagcagatattgaacaacttccttcttatcggttcaatcctaacaaccaccagtcagaacagactttgtgtgtagtatgcatgtgtgattttgagtcaaggcagctacttagagtcttaccctgtaaccacgagttccatgccaagtgtgttgacaaatggcttaaggcaaatcgtacttgcccaatttgccgagctgatgcttcagaagtgcatcgggattcagaatga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,836 Da
NCBI Official Full Name
Homo sapiens ring finger protein 38, mRNA
NCBI Official Synonym Full Names
ring finger protein 38
NCBI Official Symbol
RNF38
NCBI Protein Information
E3 ubiquitin-protein ligase RNF38
UniProt Protein Name
E3 ubiquitin-protein ligase RNF38
UniProt Gene Name
RNF38
UniProt Entry Name
RNF38_HUMAN

NCBI Description

This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Uniprot Description

RNF38: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 9p13

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: ubiquitin-protein ligase activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination; regulation of transcription, DNA-dependent

Research Articles on RNF38

Similar Products

Product Notes

The RNF38 rnf38 (Catalog #AAA1276882) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgaccat gggagatgac atcaaatagg cagccccctt cagttcgacc aagccaacat cacttctcag gggaacgatg caacacacct gcacgcaaca gaagaagtcc tcctgtcagg cgccagagag gaagaaggga tcgtctgtct cgacataatt ccattagtca agatgaaaac tatcaccatc tcccttacgc acagcagcaa gcaatagagg agcctcgagc cttccaccct ccgaatgtat ctccccgtct gctacatcct gctgctcatc caccccagca gaatgcagtc atggttgaca tacatgatca gctccatcaa ggaacagtcc ctgtttctta cacagtaaca acagtggcac cacatgggat tccactctgc acaggccagc acatccctgc ttgtagtaca cagcaggtcc caggatgctc tgtggttttc agtggacagc acctccctgt ctgtagtgtg cctcctccaa tgcttcaggc atgttcagtt cagcacttac cagtaccata tgctgcattc ccacccctta tttctagtga tccatttctt atacatcctc ctcacctttc tccccatcat cctcctcatt tgccaccacc aggccagttt gtccctttcc aaacacagca atcacgatcg cctctgcaaa ggatagaaaa tgaagtggaa ctcttaggag aacatcttcc agtaggaggt tttacttacc ctccatcagc ccacccccca acattacctc catcagctcc cttgcagttc ttaacacatg atcctttgca tcaggaggtg tcctttggag taccttatcc tccatttatg cctcggaggc ttacaggacg tagtagatac cgatcccagc agccaatacc acctccccct tatcatccca gcttactgcc atatgtgtta tcaatgcttc cagtgccacc tgcagtgggc ccaactttca gctttgaatt agatgtagaa gatggagaag tagaaaatta cgaggccctg ttaaacctgg cagagcgact gggagaggca aagcctcgtg gactgactaa agcagatatt gaacaacttc cttcttatcg gttcaatcct aacaaccacc agtcagaaca gactttgtgt gtagtatgca tgtgtgattt tgagtcaagg cagctactta gagtcttacc ctgtaaccac gagttccatg ccaagtgtgt tgacaaatgg cttaaggcaa atcgtacttg cccaatttgc cgagctgatg cttcagaagt gcatcgggat tcagaatga. It is sometimes possible for the material contained within the vial of "RNF38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual