Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NPFF cdna clone

NPFF cDNA Clone

Gene Names
NPFF; FMRFAL
Synonyms
NPFF; NPFF cDNA Clone; NPFF cdna clone
Ordering
For Research Use Only!
Sequence
ATGGTTCCGCAGCCTCCTACCACTTGCCCCTGGAAGCCAGTCCCTTCCCCTTGTGACTTACGTGTCCAGGGTATTTGCCCATCTTCCTTCCCTGATACCCCCTTGGCACAGGAGGAAGACAGCGAACCCCTCCCACCACAGGATGCCCAGACCTCTGGGTCACTGTTGCACTACCTGCTCCAGGCAATGGAGAGACCTGGCCGGAGCCAAGCCTTCCTGTTTCAGCCCCAGAGGTTTGGCAGAAATACCCAGGGATCCTGGAGGAATGAATGGCTGAGTCCCCGGGCTGGAGAGGGGCTGAATTCCCAGTTCTGGAGCCTGGCTGCCCCTCAACGCTTTGGGAAGAAGTGA
Sequence Length
351
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,991 Da
NCBI Official Full Name
Homo sapiens neuropeptide FF-amide peptide, mRNA
NCBI Official Synonym Full Names
neuropeptide FF-amide peptide precursor
NCBI Official Symbol
NPFF
NCBI Official Synonym Symbols
FMRFAL
NCBI Protein Information
pro-FMRFamide-related neuropeptide FF
UniProt Protein Name
Pro-FMRFamide-related neuropeptide FF
UniProt Gene Name
NPFF
UniProt Synonym Gene Names
NPSF; NPFF; NPAF
UniProt Entry Name
NPFF_HUMAN

NCBI Description

This gene encodes a member of the FMRFamide related peptide (FARP) family of neuropeptides. The encoded preproprotein is proteolytically processed to generate multiple amidated peptides. These peptides may play a role in the regulation of heart rate and blood pressure and the modulation of morphine-induced antinociception. Patients with hypertension exhibit decreased expression of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

Uniprot Description

NPFF: Morphine modulating peptides. Have wide-ranging physiologic effects, including the modulation of morphine-induced analgesia, elevation of arterial blood pressure, and increased somatostatin secretion from the pancreas. Neuropeptide FF potentiates and sensitizes ASIC1 and ASIC3 channels. Belongs to the FARP (FMRFamide related peptide) family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: dendrite; extracellular region; extracellular space; nerve terminal; perikaryon

Molecular Function: G-protein-coupled receptor binding; neuropeptide hormone activity; receptor binding

Biological Process: regulation of excitatory postsynaptic membrane potential; synaptic transmission

Research Articles on NPFF

Similar Products

Product Notes

The NPFF npff (Catalog #AAA1276852) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGTTCCGC AGCCTCCTAC CACTTGCCCC TGGAAGCCAG TCCCTTCCCC TTGTGACTTA CGTGTCCAGG GTATTTGCCC ATCTTCCTTC CCTGATACCC CCTTGGCACA GGAGGAAGAC AGCGAACCCC TCCCACCACA GGATGCCCAG ACCTCTGGGT CACTGTTGCA CTACCTGCTC CAGGCAATGG AGAGACCTGG CCGGAGCCAA GCCTTCCTGT TTCAGCCCCA GAGGTTTGGC AGAAATACCC AGGGATCCTG GAGGAATGAA TGGCTGAGTC CCCGGGCTGG AGAGGGGCTG AATTCCCAGT TCTGGAGCCT GGCTGCCCCT CAACGCTTTG GGAAGAAGTG A. It is sometimes possible for the material contained within the vial of "NPFF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.