Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSNK1E cdna clone

CSNK1E cDNA Clone

Gene Names
CSNK1E; HCKIE; CKIepsilon
Synonyms
CSNK1E; CSNK1E cDNA Clone; CSNK1E cdna clone
Ordering
For Research Use Only!
Sequence
atggagctacgtgtggggaacaagtaccgcctgggacggaagatcgggagcgggtccttcggagatatctacctgggtgccaacatcgcctctggtgaggaagtcgccatcaagctggagtgtgtgaagacaaagcacccccagctgcacatcgagagcaagttctacaagatgatgcagggtggcgtggggatcccgtccatcaagtggtgcggagctgagggcgactacaacgtgatggtcatggagctgctggggcctagcctcgaggacctgttcaacttctgttcccgcaaattcagcctcaagacggtgctgctcttggccgaccagatgatcagccgcatcgagtatatccactccaagaacttcatccaccgggacgtcaagcccgacaacttcctcatggggctggggaagaagggcaacctggtctacatcatcgacttcggcctggccaagaagtaccgggacgcccgcacccaccagcacattccctaccgggaaaacaagaacctgaccggcacggcccgctacgcttccatcaacacgcacctgggcattgagcaaagccgtcgagatgacctggagagcctgggctacgtgctcatgtacttcaacctgggctccctgccctggcaggggctcaaagcagccaccaagcgccagaagtatgaacggatcagcgagaagaagatgtcaacgcccatcgaggtcctctgcaaaggctatccctccgaattctcaacatacctcaacttctgccgctccctgcggtttgacgacaagcccgactactcttacctacgtcagctcttccgcaacctcttccaccggcagggcttctcctatgactacgtctttgactggaacatgctgaaattcggtgcagcccggaatcccgaggatgtggaccgggagcggcgagaacacgaacgcgaggagaggatggggcagctacgggggtccgcgacccgagccctgccccctggcccacccacgggggccactgccaaccggctccgcagtgccgccgagcccgtggcttccacgccagcctcccgcatccagccggctggcaatacttctcccagagcgatctcgcgggtcgaccgggagaggaaggtgagtatgaggctgcacaggggtgcgcccgccaacgtctcctcctcagacctcactgggcggcaagaggtctcccggatcccagcctcacagacaagtgtgccatttgaccatctcgggaagtga
Sequence Length
1251
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,315 Da
NCBI Official Full Name
Homo sapiens casein kinase 1, epsilon, mRNA
NCBI Official Synonym Full Names
casein kinase 1 epsilon
NCBI Official Symbol
CSNK1E
NCBI Official Synonym Symbols
HCKIE; CKIepsilon
NCBI Protein Information
casein kinase I isoform epsilon
UniProt Protein Name
Casein kinase I isoform epsilon
Protein Family
UniProt Gene Name
CSNK1E
UniProt Synonym Gene Names
CKI-epsilon; CKIe
UniProt Entry Name
KC1E_HUMAN

NCBI Description

The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]

Uniprot Description

CK1E: an ubiquitous protein kinase of the CK1 family. Together with Dvl-1 and Frat-1 activate the Wnt signaling pathway. Central component of the circadian clock. May act as a negative regulator of circadian rhythmicity by phosphorylating PER1 and PER2. May play a role in cell cycle progression. Two splice variant isoforms have been described. Component of the circadian core oscillator, which includes the CRY proteins, CLOCK, or NPAS2, BMAL1 or BMAL2, CK1-D and/or CK1-E, TIMELESS and the PER proteins. Interacts directly with PER1 and PER2 which may lead to their degradation. Interacts with SOCS3. Mutations in hamster and Drosophila orthologs have circadian rhythm phenotypes, and the circadian gene period (per) is a substrate in both human and fly. A coding SNP variant in human, which increases CK1 activity, is negatively associated with circadian disorder. LOF mutations and LOH seen in mammary ductal carcinoma.

Protein type: EC 2.7.11.1; Protein kinase, CK1; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); CK1 group; CK1 family

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: circadian regulation of gene expression; DNA repair; endocytosis; G2/M transition of mitotic cell cycle; negative regulation of protein binding; peptidyl-serine phosphorylation; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein amino acid phosphorylation; regulation of cell shape; regulation of circadian rhythm; rRNA processing; signal transduction; Wnt receptor signaling pathway

Research Articles on CSNK1E

Similar Products

Product Notes

The CSNK1E csnk1e (Catalog #AAA1276843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctac gtgtggggaa caagtaccgc ctgggacgga agatcgggag cgggtccttc ggagatatct acctgggtgc caacatcgcc tctggtgagg aagtcgccat caagctggag tgtgtgaaga caaagcaccc ccagctgcac atcgagagca agttctacaa gatgatgcag ggtggcgtgg ggatcccgtc catcaagtgg tgcggagctg agggcgacta caacgtgatg gtcatggagc tgctggggcc tagcctcgag gacctgttca acttctgttc ccgcaaattc agcctcaaga cggtgctgct cttggccgac cagatgatca gccgcatcga gtatatccac tccaagaact tcatccaccg ggacgtcaag cccgacaact tcctcatggg gctggggaag aagggcaacc tggtctacat catcgacttc ggcctggcca agaagtaccg ggacgcccgc acccaccagc acattcccta ccgggaaaac aagaacctga ccggcacggc ccgctacgct tccatcaaca cgcacctggg cattgagcaa agccgtcgag atgacctgga gagcctgggc tacgtgctca tgtacttcaa cctgggctcc ctgccctggc aggggctcaa agcagccacc aagcgccaga agtatgaacg gatcagcgag aagaagatgt caacgcccat cgaggtcctc tgcaaaggct atccctccga attctcaaca tacctcaact tctgccgctc cctgcggttt gacgacaagc ccgactactc ttacctacgt cagctcttcc gcaacctctt ccaccggcag ggcttctcct atgactacgt ctttgactgg aacatgctga aattcggtgc agcccggaat cccgaggatg tggaccggga gcggcgagaa cacgaacgcg aggagaggat ggggcagcta cgggggtccg cgacccgagc cctgccccct ggcccaccca cgggggccac tgccaaccgg ctccgcagtg ccgccgagcc cgtggcttcc acgccagcct cccgcatcca gccggctggc aatacttctc ccagagcgat ctcgcgggtc gaccgggaga ggaaggtgag tatgaggctg cacaggggtg cgcccgccaa cgtctcctcc tcagacctca ctgggcggca agaggtctcc cggatcccag cctcacagac aagtgtgcca tttgaccatc tcgggaagtg a. It is sometimes possible for the material contained within the vial of "CSNK1E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.