Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDKN1B cdna clone

CDKN1B cDNA Clone

Gene Names
CDKN1B; KIP1; MEN4; CDKN4; MEN1B; P27KIP1
Synonyms
CDKN1B; CDKN1B cDNA Clone; CDKN1B cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaacgtgcgagtgtctaacgggagccctagcctggagcggatggacgccaggcaggcggagcaccccaagccctcggcctgcaggaacctcttcggcccggtggaccacgaagagttaacccgggacttggagaagcactgcagagacatggaagaggcgagccagcgcaagtggaatttcgattttcagaatcacaaacccctagagggcaagtacgagtggcaagaggtggagaagggcagcttgcccgagttctactacagacccccgcggccccccaaaggtgcctgcaaggtgccggcgcaggagagccaggatggcagcgggagccgcccggcggcgcctttaattggggctccggctaactctgaggacacgcatttggtggacccaaagactgatccgtcggacagccagacggggttagcggagcaatgcgcaggaataaggaagcgacctgcaaccgacgattcttctactcaaaacaaaagagccaacagaacagaagaaaatgtttcagacggttccccaaatgccggttctgtggagcagacgcccaagaagcctggcctcagaagacgtcaaacgtaa
Sequence Length
597
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,073 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1), mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase inhibitor 1B
NCBI Official Symbol
CDKN1B
NCBI Official Synonym Symbols
KIP1; MEN4; CDKN4; MEN1B; P27KIP1
NCBI Protein Information
cyclin-dependent kinase inhibitor 1B
UniProt Protein Name
Cyclin-dependent kinase inhibitor 1B
UniProt Gene Name
CDKN1B
UniProt Synonym Gene Names
KIP1
UniProt Entry Name
CDN1B_HUMAN

NCBI Description

This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014]

Uniprot Description

p27Kip1: a cell-cycle regulatory protein that Interacts with cyclin-CDK2 and -CDK4, inhibiting cell cycle progression at G1. May mediate TGF beta-induced g1 arrest. Its degradation is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state.

Protein type: Inhibitor; Oncoprotein; Cell cycle regulation; Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 12p13.1-p12

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: caspase activator activity; cyclin-dependent protein kinase inhibitor activity; protein binding; protein phosphatase binding; transforming growth factor beta receptor, cytoplasmic mediator activity

Biological Process: autophagic cell death; caspase activation; cell cycle arrest; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; G1/S transition of mitotic cell cycle; negative regulation of cell growth; negative regulation of cell proliferation; negative regulation of kinase activity; negative regulation of mitotic cell cycle; negative regulation of phosphorylation; negative regulation of transcription, DNA-dependent; positive regulation of cell cycle; positive regulation of protein catabolic process; regulation of cyclin-dependent protein kinase activity

Disease: Multiple Endocrine Neoplasia, Type Iv

Research Articles on CDKN1B

Similar Products

Product Notes

The CDKN1B cdkn1b (Catalog #AAA1276820) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaacg tgcgagtgtc taacgggagc cctagcctgg agcggatgga cgccaggcag gcggagcacc ccaagccctc ggcctgcagg aacctcttcg gcccggtgga ccacgaagag ttaacccggg acttggagaa gcactgcaga gacatggaag aggcgagcca gcgcaagtgg aatttcgatt ttcagaatca caaaccccta gagggcaagt acgagtggca agaggtggag aagggcagct tgcccgagtt ctactacaga cccccgcggc cccccaaagg tgcctgcaag gtgccggcgc aggagagcca ggatggcagc gggagccgcc cggcggcgcc tttaattggg gctccggcta actctgagga cacgcatttg gtggacccaa agactgatcc gtcggacagc cagacggggt tagcggagca atgcgcagga ataaggaagc gacctgcaac cgacgattct tctactcaaa acaaaagagc caacagaaca gaagaaaatg tttcagacgg ttccccaaat gccggttctg tggagcagac gcccaagaag cctggcctca gaagacgtca aacgtaa. It is sometimes possible for the material contained within the vial of "CDKN1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.