Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL21 cdna clone

CCL21 cDNA Clone

Gene Names
CCL21; ECL; SLC; CKb9; TCA4; 6Ckine; SCYA21
Synonyms
CCL21; CCL21 cDNA Clone; CCL21 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagtcactggctctgagcctccttatcctggttctggcctttggcatccccaggacccaaggcagtgatggaggggctcaggactgttgcctcaagtacagccaaaggaagattcccgccaaggttgtccgcagctaccggaagcaggaaccaagcttaggctgctccatcccagctatcctgttcttgccccgcaagcgctctcaggcagagctatgtgcagacccaaaggagctctgggtgcagcagctgatgcagcatctggacaagacaccatccccacagaaaccagcccagggctgcaggaaggacaggggggcctccaagactggcaagaaaggaaagggctccaaaggctgcaagaggactgagcggtcacagacccctaaagggccatag
Sequence Length
405
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,646 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 21, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 21
NCBI Official Symbol
CCL21
NCBI Official Synonym Symbols
ECL; SLC; CKb9; TCA4; 6Ckine; SCYA21
NCBI Protein Information
C-C motif chemokine 21
UniProt Protein Name
C-C motif chemokine 21
Protein Family
UniProt Gene Name
CCL21
UniProt Synonym Gene Names
SCYA21; SLC
UniProt Entry Name
CCL21_HUMAN

NCBI Description

This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]

Uniprot Description

CCL21: Inhibits hemopoiesis and stimulates chemotaxis. Chemotactic in vitro for thymocytes and activated T-cells, but not for B-cells, macrophages, or neutrophils. Shows preferential activity towards naive T-cells. May play a role in mediating homing of lymphocytes to secondary lymphoid organs. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted; Chemokine; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 9p13

Cellular Component: extracellular region; extracellular space

Molecular Function: CCR chemokine receptor binding; CCR7 chemokine receptor binding; chemokine activity; chemokine receptor binding

Biological Process: cell maturation; cell-cell signaling; dendritic cell chemotaxis; establishment of T cell polarity; formation of immunological synapse; G-protein coupled receptor protein signaling pathway; immune response; lymphocyte chemotaxis; monocyte chemotaxis; positive regulation of actin filament polymerization; positive regulation of cell adhesion mediated by integrin; positive regulation of cell-matrix adhesion; positive regulation of chemotaxis; positive regulation of dendritic cell antigen processing and presentation; positive regulation of filopodium formation; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of JNK cascade; positive regulation of phosphoinositide 3-kinase activity; positive regulation of protein kinase activity; positive regulation of protein kinase B signaling cascade; positive regulation of pseudopodium formation; positive regulation of receptor-mediated endocytosis; release of sequestered calcium ion into cytosol; ruffle organization and biogenesis; T cell costimulation

Research Articles on CCL21

Similar Products

Product Notes

The CCL21 ccl21 (Catalog #AAA1276817) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagt cactggctct gagcctcctt atcctggttc tggcctttgg catccccagg acccaaggca gtgatggagg ggctcaggac tgttgcctca agtacagcca aaggaagatt cccgccaagg ttgtccgcag ctaccggaag caggaaccaa gcttaggctg ctccatccca gctatcctgt tcttgccccg caagcgctct caggcagagc tatgtgcaga cccaaaggag ctctgggtgc agcagctgat gcagcatctg gacaagacac catccccaca gaaaccagcc cagggctgca ggaaggacag gggggcctcc aagactggca agaaaggaaa gggctccaaa ggctgcaaga ggactgagcg gtcacagacc cctaaagggc catag. It is sometimes possible for the material contained within the vial of "CCL21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.