Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAT2 cdna clone

GNAT2 cDNA Clone

Gene Names
GNAT2; ACHM4; GNATC
Synonyms
GNAT2; GNAT2 cDNA Clone; GNAT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaagtggagccagtgctgaggacaaagaactggccaagaggtccaaggagctagaaaagaagctgcaggaggatgctgataaggaagccaagactgtcaagctgctactgctgggtgctggggagtcaggaaagagcaccatcgtcaaacagatgaagatcattcaccaggatggctattcaccagaagaatgcctggagttcaaggctatcatctatggaaatgtgctgcagtccatcctggctatcatccgggccatgaccacactgggcatcgattatgctgaaccaagctgtgcggatgacgggcgacagctcaacaacctggctgactccattgaggagggaaccatgcctcctgagctcgtggaggtcattaggaggttgtggaaggatggtggggtgcaagcctgcttcgagagagctgcagaataccagcttaatgactccgcatcttactacctgaaccaattagaacgaattacagaccctgagtacctccctagtgagcaagatgtgctccgatccagagtcaaaaccacaggcatcattgaaaccaagttttccgtcaaagacttgaatttcaggatgtttgatgtgggagggcagagatccgagagaaagaagtggatccactgcttcgagggagtcacctgcatcattttctgtgcagccctcagtgcctatgatatggtgctggtggaagatgacgaagtgaatcgtatgcatgagtctttgcatctgttcaacagcatatgtaaccacaaattctttgcggctacttccattgtcctctttctcaacaagaaggacctctttgaggaaaaaatcaagaaagtccatctcagcatttgttttccagagtatgatggtaacaactcctatgatgatgcggggaattacataaagagccagttccttgacctcaatatgcgaaaagatgtcaaagaaatctacagtcacatgacctgtgctacagatacacagaatgtcaaatttgtgtttgatgcagttacagatattatcatcaaagaaaacctcaaggactgcggcctcttctaa
Sequence Length
1065
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,176 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha transducin 2
NCBI Official Symbol
GNAT2
NCBI Official Synonym Symbols
ACHM4; GNATC
NCBI Protein Information
guanine nucleotide-binding protein G(t) subunit alpha-2
UniProt Protein Name
Guanine nucleotide-binding protein G(t) subunit alpha-2
UniProt Gene Name
GNAT2
UniProt Synonym Gene Names
GNATC
UniProt Entry Name
GNAT2_HUMAN

NCBI Description

Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]

Uniprot Description

G-alpha t2: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. Transducin is an amplifier and one of the transducers of a visual impulse that performs the coupling between rhodopsin and cGMP-phosphodiesterase. Defects in GNAT2 are the cause of achromatopsia type 4 (ACHM4). Achromatopsia is an autosomal recessively inherited visual disorder that is present from birth and that features the absence of color discrimination. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

Protein type: G protein, heterotrimeric alpha G((i/o/t/z)); G protein, heterotrimeric; G protein

Chromosomal Location of Human Ortholog: 1p13.1

Cellular Component: heterotrimeric G-protein complex; photoreceptor inner segment; photoreceptor outer segment; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; G-protein-coupled receptor binding; GTP binding; GTPase activity; signal transducer activity

Biological Process: detection of chemical stimulus involved in sensory perception of bitter taste; detection of light stimulus involved in visual perception; G-protein signaling, coupled to cAMP nucleotide second messenger; protein folding; Wnt receptor signaling pathway, calcium modulating pathway

Disease: Achromatopsia 4

Research Articles on GNAT2

Similar Products

Product Notes

The GNAT2 gnat2 (Catalog #AAA1276807) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaagtg gagccagtgc tgaggacaaa gaactggcca agaggtccaa ggagctagaa aagaagctgc aggaggatgc tgataaggaa gccaagactg tcaagctgct actgctgggt gctggggagt caggaaagag caccatcgtc aaacagatga agatcattca ccaggatggc tattcaccag aagaatgcct ggagttcaag gctatcatct atggaaatgt gctgcagtcc atcctggcta tcatccgggc catgaccaca ctgggcatcg attatgctga accaagctgt gcggatgacg ggcgacagct caacaacctg gctgactcca ttgaggaggg aaccatgcct cctgagctcg tggaggtcat taggaggttg tggaaggatg gtggggtgca agcctgcttc gagagagctg cagaatacca gcttaatgac tccgcatctt actacctgaa ccaattagaa cgaattacag accctgagta cctccctagt gagcaagatg tgctccgatc cagagtcaaa accacaggca tcattgaaac caagttttcc gtcaaagact tgaatttcag gatgtttgat gtgggagggc agagatccga gagaaagaag tggatccact gcttcgaggg agtcacctgc atcattttct gtgcagccct cagtgcctat gatatggtgc tggtggaaga tgacgaagtg aatcgtatgc atgagtcttt gcatctgttc aacagcatat gtaaccacaa attctttgcg gctacttcca ttgtcctctt tctcaacaag aaggacctct ttgaggaaaa aatcaagaaa gtccatctca gcatttgttt tccagagtat gatggtaaca actcctatga tgatgcgggg aattacataa agagccagtt ccttgacctc aatatgcgaa aagatgtcaa agaaatctac agtcacatga cctgtgctac agatacacag aatgtcaaat ttgtgtttga tgcagttaca gatattatca tcaaagaaaa cctcaaggac tgcggcctct tctaa. It is sometimes possible for the material contained within the vial of "GNAT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.