Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL2A1 cdna clone

COL2A1 cDNA Clone

Gene Names
COL2A1; AOM; ANFH; SEDC; STL1; COL11A3
Synonyms
COL2A1; COL2A1 cDNA Clone; COL2A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgcctttgctggcttaggcccgagagagaagggccccgaccccctgcagtacatgcgggccgaccaggcagccggtggcctgagacagcatgacgccgaggtggatgccacactcaagtccctcaacaaccagattgagagcatccgcagccccgagggctcccgcaagaaccctgctcgcacctgcagagacctgaaactctgccaccctgagtggaagagtggagactactggattgaccccaaccaaggctgcaccttggacgccatgaaggttttctgcaacatggagactggcgagacttgcgtctaccccaatccagcaaacgttcccaagaagaactggtggagcagcaagagcaaggagaagaaacacatctggtttggagaaaccatcaatggtggcttccatttcagctatggagatgacaatctggctcccaacactgccaacgtccagatgaccttcctacgcctgctgtccacggaaggctcccagaacatcacctaccactgcaagaacagcattgcctatctggacgaagcagctggcaacctcaagaaggccctgctcatccagggctccaatgacgtggagatccgggcagagggcaatagcaggttcacgtacactgccctgaaggatggctgcacgaaacataccggtaagtggggcaagactgttatcgagtaccggtcacagaagacctcacgcctccccatcattgacattgcacccatggacataggagggcccgagcaggaattcggtgtggacatagggccggtctgcttcttgtaa
Sequence Length
807
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,781
NCBI Official Full Name
Homo sapiens collagen, type II, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type II alpha 1 chain
NCBI Official Symbol
COL2A1
NCBI Official Synonym Symbols
AOM; ANFH; SEDC; STL1; COL11A3
NCBI Protein Information
collagen alpha-1(II) chain
UniProt Protein Name
Collagen alpha-1(II) chain
UniProt Gene Name
COL2A1
UniProt Entry Name
CO2A1_HUMAN

NCBI Description

This gene encodes the alpha-1 chain of type II collagen, a fibrillar collagen found in cartilage and the vitreous humor of the eye. Mutations in this gene are associated with achondrogenesis, chondrodysplasia, early onset familial osteoarthritis, SED congenita, Langer-Saldino achondrogenesis, Kniest dysplasia, Stickler syndrome type I, and spondyloepimetaphyseal dysplasia Strudwick type. In addition, defects in processing chondrocalcin, a calcium binding protein that is the C-propeptide of this collagen molecule, are also associated with chondrodysplasia. There are two transcripts identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

COL2A1: the alpha-1 chain of type II collagen, an extra-cellular matrix protein found in cartilage and the vitreous humor of the eye. It is essential for the normal embryonic development of the skeleton, for linear growth and for the ability of cartilage to resist compressive forces. Chondrocalcin is the calcium binding C-propeptide of this collagen molecule. Defects in this protein are associated with achondrogenesis, chondrodysplasia, early onset familial osteoarthritis, SED congenita, Langer-Saldino achondrogenesis, Kniest dysplasia, Stickler syndrome type I, and spondyloepimetaphyseal dysplasia Strudwick type. There are two transcripts identified for this gene. Belongs to the fibrillar collagen family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide; Extracellular matrix

Chromosomal Location of Human Ortholog: 12q13.11

Cellular Component: collagen type II; endoplasmic reticulum lumen; extracellular matrix; extracellular region

Molecular Function: extracellular matrix structural constituent conferring tensile strength; platelet-derived growth factor binding

Biological Process: cartilage development; collagen catabolic process; collagen fibril organization; extracellular matrix organization and biogenesis; regulation of immune response; sensory perception of sound; skeletal development; visual perception

Disease: Achondrogenesis, Type Ii; Avascular Necrosis Of Femoral Head, Primary; Czech Dysplasia; Epiphyseal Dysplasia, Multiple, With Myopia And Conductive Deafness; Kniest Dysplasia; Legg-calve-perthes Disease; Osteoarthritis With Mild Chondrodysplasia; Otospondylomegaepiphyseal Dysplasia; Platyspondylic Lethal Skeletal Dysplasia, Torrance Type; Spondyloepimetaphyseal Dysplasia, Strudwick Type; Spondyloepiphyseal Dysplasia Congenita; Spondyloepiphyseal Dysplasia, Stanescu Type; Spondyloperipheral Dysplasia; Stickler Syndrome, Type I; Stickler Syndrome, Type I, Nonsyndromic Ocular

Research Articles on COL2A1

Similar Products

Product Notes

The COL2A1 col2a1 (Catalog #AAA1276796) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgcct ttgctggctt aggcccgaga gagaagggcc ccgaccccct gcagtacatg cgggccgacc aggcagccgg tggcctgaga cagcatgacg ccgaggtgga tgccacactc aagtccctca acaaccagat tgagagcatc cgcagccccg agggctcccg caagaaccct gctcgcacct gcagagacct gaaactctgc caccctgagt ggaagagtgg agactactgg attgacccca accaaggctg caccttggac gccatgaagg ttttctgcaa catggagact ggcgagactt gcgtctaccc caatccagca aacgttccca agaagaactg gtggagcagc aagagcaagg agaagaaaca catctggttt ggagaaacca tcaatggtgg cttccatttc agctatggag atgacaatct ggctcccaac actgccaacg tccagatgac cttcctacgc ctgctgtcca cggaaggctc ccagaacatc acctaccact gcaagaacag cattgcctat ctggacgaag cagctggcaa cctcaagaag gccctgctca tccagggctc caatgacgtg gagatccggg cagagggcaa tagcaggttc acgtacactg ccctgaagga tggctgcacg aaacataccg gtaagtgggg caagactgtt atcgagtacc ggtcacagaa gacctcacgc ctccccatca ttgacattgc acccatggac ataggagggc ccgagcagga attcggtgtg gacatagggc cggtctgctt cttgtaa. It is sometimes possible for the material contained within the vial of "COL2A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.