Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPACA3 cdna clone

SPACA3 cDNA Clone

Gene Names
SPACA3; CT54; LYC3; LYZC; LYZL3; SLLP1; ALLP17
Synonyms
SPACA3; SPACA3 cDNA Clone; SPACA3 cdna clone
Ordering
For Research Use Only!
Sequence
ATGACTTCGGGCTGGACGGATACCGGGGATACAGCCTGGCTGACTGCCTATGCTCTGCCCTATGCAGGGGTCTGCCTTGCTTATTTCACAAGCGGTTTCAACGCAGCTGCTTTGGACTACGAGGCTGATGGGAGCACCAACAACGGGATCTTCCAGATCAACAGCCGGAGGTGGTGCAGCAACCTCACCCCGAACGTCCCCAACGTGTGCCGGATGTACTGCTCAGATTTGTTGAATCCTAATCTCAAGGATACCGTTATCTGTGCCATGAAGATAACCCAAGAGCCTCAGGGTCTGGGTTACTGGGAGGCCTGGAGGCATCACTGCCAGGGAAAAGACCTCACTGAATGGGTGGATGGCTGTGACTTCTAG
Sequence Length
372
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,430 Da
NCBI Official Full Name
Homo sapiens sperm acrosome associated 3, mRNA
NCBI Official Synonym Full Names
sperm acrosome associated 3
NCBI Official Symbol
SPACA3
NCBI Official Synonym Symbols
CT54; LYC3; LYZC; LYZL3; SLLP1; ALLP17
NCBI Protein Information
sperm acrosome membrane-associated protein 3
UniProt Protein Name
Sperm acrosome membrane-associated protein 3
UniProt Gene Name
SPACA3
UniProt Synonym Gene Names
LYC3; LYZL3; SLLP1; SPRASA; CT54; Sperm protein reactive with ASA
UniProt Entry Name
SACA3_HUMAN

NCBI Description

The protein encoded by this gene is a sperm surface protein that may be involved in adhesion to the egg prior to fertilization. While the encoded protein has significant similarity to lysozyme at the amino acid level, it has no detectable bacteriocidal activity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Uniprot Description

SPACA3: a single-pass type II sperm surface membrane protein that may be involved in sperm-egg plasma membrane adhesion and fusion during fertilization. It could be a potential receptor for the egg oligosaccharide residue N-acetylglucosamine, which is present in the extracellular matrix over the egg plasma membrane. A member of the Cancer-Testis Antigen (CTA) superfamily. CTAs may play roles in embryonal development and tumor transformation or aspects of tumor progression. CTAs were once thought to be silenced in most normal adult tissues, with limited expression in fetal, placental, testis, and ovarian cells. These proteins are now known to be aberrantly expressed in various cancers and many are capable of eliciting humoral and cellular immune responses. Expressed in testis, epididymis and placenta. Although it belongs to the glycosyl hydrolase 22 family, T122 and N139 are present instead of the conserved Glu and Asp which are active site residues. It is therefore expected that this protein lacks hydrolase activity. Two isoforms of the human protein are produced by alternative splicing. Note: This description may include information from RefSeq and UniProtKB

Protein type: Membrane protein, integral; Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: extracellular region; lysosome; secretory granule

Molecular Function: lysozyme activity; protein binding

Biological Process: cell wall catabolic process; defense response to Gram-positive bacterium; monocyte activation; peptidoglycan catabolic process; positive regulation of macrophage activation; positive regulation of phagocytosis; response to virus

Research Articles on SPACA3

Similar Products

Product Notes

The SPACA3 spaca3 (Catalog #AAA1276780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGACTTCGG GCTGGACGGA TACCGGGGAT ACAGCCTGGC TGACTGCCTA TGCTCTGCCC TATGCAGGGG TCTGCCTTGC TTATTTCACA AGCGGTTTCA ACGCAGCTGC TTTGGACTAC GAGGCTGATG GGAGCACCAA CAACGGGATC TTCCAGATCA ACAGCCGGAG GTGGTGCAGC AACCTCACCC CGAACGTCCC CAACGTGTGC CGGATGTACT GCTCAGATTT GTTGAATCCT AATCTCAAGG ATACCGTTAT CTGTGCCATG AAGATAACCC AAGAGCCTCA GGGTCTGGGT TACTGGGAGG CCTGGAGGCA TCACTGCCAG GGAAAAGACC TCACTGAATG GGTGGATGGC TGTGACTTCT AG. It is sometimes possible for the material contained within the vial of "SPACA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.