Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R16A cdna clone

PPP1R16A cDNA Clone

Gene Names
PPP1R16A; MYPT3
Synonyms
PPP1R16A; PPP1R16A cDNA Clone; PPP1R16A cdna clone
Ordering
For Research Use Only!
Sequence
atggccgagcacctggagctgctggcagagatgcccatggtgggcaggatgagcacacaggagcggctgaagcatgcccagaagcggcgcgcccagcaggtgaagatgtgggcccaggctgagaaggaggcccagggcaagaagggtcctggggagcgtccccggaaggaggcagccagccaagggctcctgaagcaggtcctcttccctcccagtgttgtccttctggaggccgctgcccgaaatgacctggaagaagtccgccagttccttgggagtggggtcagccctgacttggccaacgaggacggcctgacggccctgcaccagtgctgcattgatgatttccgagagatggtgcagcagctcctggaggctggggccaacatcaatgcctgtgacagtgagtgctggacgcctctgcatgctgcggccacctgcggccacctgcacctggtggagctgctcatcgccagtggcgccaatctcctggcggtcaacaccgacgggaacatgccctatgacctgtgtgatgatgagcagacgctggactgcctggagactgccatggccgaccgtggcatcacccaggacagcatcgaggccgcccgggccgtgccagaactgcgcatgctggacgacatccggagccggctgcaggccggggcagacctccatgcccccctggaccacggggccacgctgctgcacgtcgcagccgccaacgggttcagcgaggcggctgccctgctgctggaacaccgagccagcctgagcgctaaggaccaagacggctgggagccgctgcacgccgcggcctactggggccaggtgcccctggtggagctgctcgtggcgcacggggccgacctgaacgcaaagtccctgatggacgagacgccccttgatgtgtgcggggacgaggaggtgcgggccaagctgctggagctgaagcacaagcacgacgccctcctgcgcgcccagagccgccagcgctccttgctgcgccgccgcacctccagcgccggcagccgcgggaaggtggtgaggcgggtgagcctaacccagcgcaccgacctgtaccgcaagcagcacgcccaggaggccatcgtgtggcaacagccgccgcccaccagcccggagccgcccgaggacaacgatgaccgccagacaggcgcagagctcaggccgccgcccccggaggaggacaaccccgaagtggtcaggccgcacaatggccgagtagggggctccccagtgcggcatctatactccaagcgactagaccggagtgtctcctaccagctgagccccctggacagcaccaccccccacaccctggtccacgacaaggcccaccacaccctggctgacctgaagcgccagcgagctgctgccaagctgcagcgacccccacctgaggggcccgagagccctgagacagctgagcctggcctgcctggtgacacggtgaccccccagcctgactgtggcttcagggcaggcggggacccacccctgctcaagctcacagccccggcggtggaggctcccgtggagaggaggccgtgctgcctgctcatgtga
Sequence Length
1587
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,811 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 16A, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 16A
NCBI Official Symbol
PPP1R16A
NCBI Official Synonym Symbols
MYPT3
NCBI Protein Information
protein phosphatase 1 regulatory subunit 16A
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 16A
UniProt Gene Name
PPP1R16A
UniProt Synonym Gene Names
MYPT3
UniProt Entry Name
PP16A_HUMAN

NCBI Description

Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]

Uniprot Description

PPP1R16A: Inhibits protein phosphatase 1 activity toward phosphorylase, myosin light chain and myosin substrates.

Protein type: Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 8q24.3

Molecular Function: protein binding

Research Articles on PPP1R16A

Similar Products

Product Notes

The PPP1R16A ppp1r16a (Catalog #AAA1276735) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagc acctggagct gctggcagag atgcccatgg tgggcaggat gagcacacag gagcggctga agcatgccca gaagcggcgc gcccagcagg tgaagatgtg ggcccaggct gagaaggagg cccagggcaa gaagggtcct ggggagcgtc cccggaagga ggcagccagc caagggctcc tgaagcaggt cctcttccct cccagtgttg tccttctgga ggccgctgcc cgaaatgacc tggaagaagt ccgccagttc cttgggagtg gggtcagccc tgacttggcc aacgaggacg gcctgacggc cctgcaccag tgctgcattg atgatttccg agagatggtg cagcagctcc tggaggctgg ggccaacatc aatgcctgtg acagtgagtg ctggacgcct ctgcatgctg cggccacctg cggccacctg cacctggtgg agctgctcat cgccagtggc gccaatctcc tggcggtcaa caccgacggg aacatgccct atgacctgtg tgatgatgag cagacgctgg actgcctgga gactgccatg gccgaccgtg gcatcaccca ggacagcatc gaggccgccc gggccgtgcc agaactgcgc atgctggacg acatccggag ccggctgcag gccggggcag acctccatgc ccccctggac cacggggcca cgctgctgca cgtcgcagcc gccaacgggt tcagcgaggc ggctgccctg ctgctggaac accgagccag cctgagcgct aaggaccaag acggctggga gccgctgcac gccgcggcct actggggcca ggtgcccctg gtggagctgc tcgtggcgca cggggccgac ctgaacgcaa agtccctgat ggacgagacg ccccttgatg tgtgcgggga cgaggaggtg cgggccaagc tgctggagct gaagcacaag cacgacgccc tcctgcgcgc ccagagccgc cagcgctcct tgctgcgccg ccgcacctcc agcgccggca gccgcgggaa ggtggtgagg cgggtgagcc taacccagcg caccgacctg taccgcaagc agcacgccca ggaggccatc gtgtggcaac agccgccgcc caccagcccg gagccgcccg aggacaacga tgaccgccag acaggcgcag agctcaggcc gccgcccccg gaggaggaca accccgaagt ggtcaggccg cacaatggcc gagtaggggg ctccccagtg cggcatctat actccaagcg actagaccgg agtgtctcct accagctgag ccccctggac agcaccaccc cccacaccct ggtccacgac aaggcccacc acaccctggc tgacctgaag cgccagcgag ctgctgccaa gctgcagcga cccccacctg aggggcccga gagccctgag acagctgagc ctggcctgcc tggtgacacg gtgacccccc agcctgactg tggcttcagg gcaggcgggg acccacccct gctcaagctc acagccccgg cggtggaggc tcccgtggag aggaggccgt gctgcctgct catgtga. It is sometimes possible for the material contained within the vial of "PPP1R16A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.