Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANP32B cdna clone

ANP32B cDNA Clone

Gene Names
ANP32B; APRIL; SSP29; PHAPI2
Synonyms
ANP32B; ANP32B cDNA Clone; ANP32B cdna clone
Ordering
For Research Use Only!
Sequence
atggacatgaagaggaggatccacctggagctgaggaaccggaccccggcagctgttcgagaacttgtcttggacaattgcaaatcaaatgatggaaaaattgagggcttaacagctgaatttgtgaacttagagttcctcagtttaataaatgtaggcttgatctcagtttcaaatctccccaagctgcctaaattgaaaaagcttgaactcagtgaaaatagaatctttggaggtctggacatgttagctgaaaaacttccaaatctcacacatctaaacttaagtggaaataaactgaaagatatcagcaccttggaacctttgaaaaagttagaatgtctgaaaagcctggacctctttaactgtgaggttaccaacctgaatgactaccgagagagtgtcttcaagctcctgccccagcttacctacttggatggctatgaccgagaggaccaggaagcacctgactcagatgccgaggtggatggtgtggatgaagaggaggaggacgaagaaggagaagatgaggaagacgaggacgatgaggatggtgaagaagaggagtttgatgaagaagatgatgaagatgaagatgtagaaggggatgaggacgacgatgaagtcagtgaggaggaagaagaatttggacttgatgaagaagatgaagatgaggatgaggatgaagaggaggaagaaggtgggaaaggtgaaaagaggaagagagaaacagatgatgaaggagaagatgattaa
Sequence Length
756
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,277 Da
NCBI Official Full Name
Homo sapiens acidic (leucine-rich) nuclear phosphoprotein 32 family, member B, mRNA
NCBI Official Synonym Full Names
acidic nuclear phosphoprotein 32 family member B
NCBI Official Symbol
ANP32B
NCBI Official Synonym Symbols
APRIL; SSP29; PHAPI2
NCBI Protein Information
acidic leucine-rich nuclear phosphoprotein 32 family member B
UniProt Protein Name
Acidic leucine-rich nuclear phosphoprotein 32 family member B
UniProt Gene Name
ANP32B
UniProt Synonym Gene Names
APRIL; PHAPI2; PHAPI2
UniProt Entry Name
AN32B_HUMAN

Uniprot Description

ANP32B: Multifunctional protein working as a cell cycle progression factor as well as a cell survival factor. Required for the progression from the G1 to the S phase. Anti-apoptotic protein which functions as a caspase-3 inhibitor. Has no phosphatase 2A (PP2A) inhibitor activity. Exhibits histone chaperone properties, stimulating core histones to assemble into a nucleosome. Belongs to the ANP32 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone

Chromosomal Location of Human Ortholog: 9q22.32

Cellular Component: cytoplasm; nucleolus; nucleus

Molecular Function: histone binding; protein binding

Biological Process: caspase activation; negative regulation of cell differentiation; nucleosome assembly; positive regulation of protein export from nucleus

Research Articles on ANP32B

Similar Products

Product Notes

The ANP32B anp32b (Catalog #AAA1276731) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatga agaggaggat ccacctggag ctgaggaacc ggaccccggc agctgttcga gaacttgtct tggacaattg caaatcaaat gatggaaaaa ttgagggctt aacagctgaa tttgtgaact tagagttcct cagtttaata aatgtaggct tgatctcagt ttcaaatctc cccaagctgc ctaaattgaa aaagcttgaa ctcagtgaaa atagaatctt tggaggtctg gacatgttag ctgaaaaact tccaaatctc acacatctaa acttaagtgg aaataaactg aaagatatca gcaccttgga acctttgaaa aagttagaat gtctgaaaag cctggacctc tttaactgtg aggttaccaa cctgaatgac taccgagaga gtgtcttcaa gctcctgccc cagcttacct acttggatgg ctatgaccga gaggaccagg aagcacctga ctcagatgcc gaggtggatg gtgtggatga agaggaggag gacgaagaag gagaagatga ggaagacgag gacgatgagg atggtgaaga agaggagttt gatgaagaag atgatgaaga tgaagatgta gaaggggatg aggacgacga tgaagtcagt gaggaggaag aagaatttgg acttgatgaa gaagatgaag atgaggatga ggatgaagag gaggaagaag gtgggaaagg tgaaaagagg aagagagaaa cagatgatga aggagaagat gattaa. It is sometimes possible for the material contained within the vial of "ANP32B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.