ASAP3 cdna clone
ASAP3 cDNA Clone
Gene Names
ASAP3; ACAP4; UPLC1; CENTB6; DDEFL1
Synonyms
ASAP3; ASAP3 cDNA Clone; ASAP3 cdna clone
Sequence
atgccggagcagttcagcgtcgccgagttcctggccgtcaccgcggaggacctcagctccccggctggggccgccgccttcgccgccaagatgccccggtaccgaggggcggcgctggcgcgggaggagatcttggaaggagaccaagccatcctgcagagaataaagaaggctgtgcgggcaatccatagctccggccttggccatgtggagaatgaagagcagtaccgagaggccgtggaatccttaggcaacagccacctgtcccagaacagccatgagctgtccacaggcttcctaaacttggccgtgttcacccgcgaggttgctgcgctcttcaagaacctgattcagaacttgaacaacattgtctctttccccctggacagtctgatgaaggggcagctgagggacggtcgacaggattccaaaaaacagctggagaaggcatggaaggactatgaagccaaaatggccaagctggagaaggagcgcgatcgggccagggtgacaggagggatccctggggaggtggcccaggacatgcagagagagcggcgcatcttccagctgcacatgtgtgagtatctgctcaaagccggggagagccagatgaagcaaggtcctgacttccttcagagcctcatcaagttcttccacgcccagcacaactttttccaagatggctggaaggctgcccagagcctgttccccttcatcgagaagctggcggcctcagtacatgcactccatcaggcccaggaggacgaactacagaagctgacccagctccgggactccctccgagggacactgcagcttgagagcagagaggaacacctgagccggaagaactcaggatgtggctatagcatccaccagcaccaaggcaacaagcagtttgggacggagaaagtgggctttctatacaagaaaagtgacggaattcgaagagcctggcagaaaaggaagtgtggagtcaagtatggctgcctgaccatctcacacagcacgataaaccggcccccggtgaagctgaccctgctgacgtgccaagtgaggccaaaccctgaggagaaaaagtgcttcgacctggtgacccacaaccggacgtaccactttcaggcagaggacgagcacgagtgtgaggcgtgggtgtcagtgttgcagaacagcaaggacgaagccctgagcagcgccttcctcggggagcccagcgctggcccggggtcctgggggtccgccggccatgatggggagccgcacgacctcacaaagctgctcatcgcggaggtgaagagcaggcctgggaatagccagtgctgcgactgcggggctgcagaccccacgtggctcagcaccaacctgggcgtgctcacctgcatccagtgctcgggcgtccaccgcgaactgggcgtgcgcttttcgcgcatgcagtcactcaccttggacctgctgggcccctccgagttgttgctggccttgaacatgggaaacacgagcttcaatgaggtcatggaggcccagctaccctcacacggcggccctaaaccctcagctgagagtgacatgggcacccgcagggactacattatggccaagtatgtggagcataggtttgcacgccggtgcacacctgagcctcagcgactctggacagccatttgcaacagggacctcctgtcggtactggaggcctttgccaatgggcaggactttggacagccgctgccagggcctgatgcacaggcacctgaagaactcgtcttgcatttggctgtcaaagtcgccaaccaggcttccctgcctctggtggatttcatcatccagaacggtggtcacctggatgccaaggctgctgacgggaacacggctctgcactacgcagcactctacaaccagcccgactgcctcaagctgctgctgaaggggagagctttggttggcacagtaaatgaagcaggcgagacagctctggacatagccaggaagaagcaccacaaggagtgtgaggagctgctggagcaggcccaggcggggacctttgccttccctctacatgtggactactcctgggtaatttccacagagcctggctctgacagtgaggaggatgaggaagagaagcgctgcttgctgaagctcccggcccaggctcactgggccagtgggaggctggacatcagcaacaagacctatgagactgtcgccagcctgggagcagccacccctcagggcgagagtgaggactgtcccccgcccttgccagtcaaaaactcttctcggactttggtccaagggtgtgcaagacatgccagtggagatcgttctgaagtctccagcctgagttcagaggcccctgagacccctgagagcctgggcagtccagcctcctcctccagtctgatgagccccttggaacctggggatcccagccaagccccacccaactctgaagagggcctccgagagcccccaggcacctccagacccagcctgacatccgggaccaccccttcggagatgtacctccccgtcagattcagctccgagagcactcgctcctatcggcggggggcgcggagccctgaagatggtccctcagccaggcagcctctgcccagaaggaacgtgccggttggcatcactgaaggagatggctcaaggactgggagtctcccagcaagttctgtgcaacttttgcaagactag
Sequence Length
2712
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
97,847 Da
NCBI Official Full Name
Homo sapiens ArfGAP with SH3 domain, ankyrin repeat and PH domain 3, mRNA
NCBI Official Synonym Full Names
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
NCBI Official Symbol
ASAP3
NCBI Official Synonym Symbols
ACAP4; UPLC1; CENTB6; DDEFL1
NCBI Protein Information
arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 3
UniProt Protein Name
Arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 3
UniProt Gene Name
ASAP3
UniProt Synonym Gene Names
DDEFL1; UPLC1
UniProt Entry Name
ASAP3_HUMAN
NCBI Description
This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Uniprot Description
DDEFL1: Promotes cell proliferation. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: GAPs; GAPs, ARF; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 1p36.12
Cellular Component: focal adhesion; ruffle
Molecular Function: GTPase activator activity; protein binding
Biological Process: cell migration; positive regulation of GTPase activity; regulation of stress fiber formation
Research Articles on ASAP3
Similar Products
Product Notes
The ASAP3 asap3 (Catalog #AAA1276713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggagc agttcagcgt cgccgagttc ctggccgtca ccgcggagga cctcagctcc ccggctgggg ccgccgcctt cgccgccaag atgccccggt accgaggggc ggcgctggcg cgggaggaga tcttggaagg agaccaagcc atcctgcaga gaataaagaa ggctgtgcgg gcaatccata gctccggcct tggccatgtg gagaatgaag agcagtaccg agaggccgtg gaatccttag gcaacagcca cctgtcccag aacagccatg agctgtccac aggcttccta aacttggccg tgttcacccg cgaggttgct gcgctcttca agaacctgat tcagaacttg aacaacattg tctctttccc cctggacagt ctgatgaagg ggcagctgag ggacggtcga caggattcca aaaaacagct ggagaaggca tggaaggact atgaagccaa aatggccaag ctggagaagg agcgcgatcg ggccagggtg acaggaggga tccctgggga ggtggcccag gacatgcaga gagagcggcg catcttccag ctgcacatgt gtgagtatct gctcaaagcc ggggagagcc agatgaagca aggtcctgac ttccttcaga gcctcatcaa gttcttccac gcccagcaca actttttcca agatggctgg aaggctgccc agagcctgtt ccccttcatc gagaagctgg cggcctcagt acatgcactc catcaggccc aggaggacga actacagaag ctgacccagc tccgggactc cctccgaggg acactgcagc ttgagagcag agaggaacac ctgagccgga agaactcagg atgtggctat agcatccacc agcaccaagg caacaagcag tttgggacgg agaaagtggg ctttctatac aagaaaagtg acggaattcg aagagcctgg cagaaaagga agtgtggagt caagtatggc tgcctgacca tctcacacag cacgataaac cggcccccgg tgaagctgac cctgctgacg tgccaagtga ggccaaaccc tgaggagaaa aagtgcttcg acctggtgac ccacaaccgg acgtaccact ttcaggcaga ggacgagcac gagtgtgagg cgtgggtgtc agtgttgcag aacagcaagg acgaagccct gagcagcgcc ttcctcgggg agcccagcgc tggcccgggg tcctgggggt ccgccggcca tgatggggag ccgcacgacc tcacaaagct gctcatcgcg gaggtgaaga gcaggcctgg gaatagccag tgctgcgact gcggggctgc agaccccacg tggctcagca ccaacctggg cgtgctcacc tgcatccagt gctcgggcgt ccaccgcgaa ctgggcgtgc gcttttcgcg catgcagtca ctcaccttgg acctgctggg cccctccgag ttgttgctgg ccttgaacat gggaaacacg agcttcaatg aggtcatgga ggcccagcta ccctcacacg gcggccctaa accctcagct gagagtgaca tgggcacccg cagggactac attatggcca agtatgtgga gcataggttt gcacgccggt gcacacctga gcctcagcga ctctggacag ccatttgcaa cagggacctc ctgtcggtac tggaggcctt tgccaatggg caggactttg gacagccgct gccagggcct gatgcacagg cacctgaaga actcgtcttg catttggctg tcaaagtcgc caaccaggct tccctgcctc tggtggattt catcatccag aacggtggtc acctggatgc caaggctgct gacgggaaca cggctctgca ctacgcagca ctctacaacc agcccgactg cctcaagctg ctgctgaagg ggagagcttt ggttggcaca gtaaatgaag caggcgagac agctctggac atagccagga agaagcacca caaggagtgt gaggagctgc tggagcaggc ccaggcgggg acctttgcct tccctctaca tgtggactac tcctgggtaa tttccacaga gcctggctct gacagtgagg aggatgagga agagaagcgc tgcttgctga agctcccggc ccaggctcac tgggccagtg ggaggctgga catcagcaac aagacctatg agactgtcgc cagcctggga gcagccaccc ctcagggcga gagtgaggac tgtcccccgc ccttgccagt caaaaactct tctcggactt tggtccaagg gtgtgcaaga catgccagtg gagatcgttc tgaagtctcc agcctgagtt cagaggcccc tgagacccct gagagcctgg gcagtccagc ctcctcctcc agtctgatga gccccttgga acctggggat cccagccaag ccccacccaa ctctgaagag ggcctccgag agcccccagg cacctccaga cccagcctga catccgggac caccccttcg gagatgtacc tccccgtcag attcagctcc gagagcactc gctcctatcg gcggggggcg cggagccctg aagatggtcc ctcagccagg cagcctctgc ccagaaggaa cgtgccggtt ggcatcactg aaggagatgg ctcaaggact gggagtctcc cagcaagttc tgtgcaactt ttgcaagact ag. It is sometimes possible for the material contained within the vial of "ASAP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
