Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIAA1967 cdna clone

KIAA1967 cDNA Clone

Gene Names
CCAR2; DBC1; DBC-1; NET35; p30DBC; p30 DBC; KIAA1967
Synonyms
KIAA1967; KIAA1967 cDNA Clone; KIAA1967 cdna clone
Ordering
For Research Use Only!
Sequence
atgctactgagccttcctgaaaaggtcgtgtccccacctgaacctgagaaggaggaggcggccaaggaagaagccaccaaggaggaagaagccatcaaagaggaggtggtcaaggagcccaaggatgaggcacagaatgagggcccggctacagagtcagaggccccgctgaaggaggatgggcttttgcccaaaccactctcttctgggggagaggaagaagaaaaaccccggggcgaggcttctgaggacctgtgtgagatggccctggacccagaactgttgcttctgagggatgatggagaggaggagtttgcaggagcaaagctggaggattcggaggtccggtccgttgcctcaaaccagtcagagatggagttctcttcacttcaggacatgcccaaggagctggatccctctgctgtgctccccttagactgtctgcttgcttttgtgttctttgatgccaactggtgtggctacttgcaccggcgagacttagagaggatcctccttacccttgggatccggctcagtgcagagcaggccaagcagctggtcagcagggtggtgacccagaacatctgccagtaccggagccttcagtacagccgccaggagggcctggatggtggccttcccgaggaggtgctcttcggaaacctggacctgctgccccctcctgggaaaagcacgaagccaggtgctgcccccacagaacacaaagccttggtgtcccacaatggcagcctgattaacgtggggagcctgctgcagcgcgcggagcagcaggacagcggccggctctacctagagaacaagatccacacactggagctgaagctggaggagagccataaccgtttctcagccactgaagtaaccaataagacgctggcggcagagatgcaggagctgcgagtccggctggcggaggccgaggagaccgcccggacggcggagcgacagaagagccagctccagcggctgctgcaggagctccgcaggcgtctgacccccctgcagctggagatccagcgggtggtggaaaaggctgacagctgggtggagaaggaggagccggcacctagcaactga
Sequence Length
1098
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
103,143 Da
NCBI Official Full Name
Homo sapiens KIAA1967, mRNA
NCBI Official Synonym Full Names
cell cycle and apoptosis regulator 2
NCBI Official Symbol
CCAR2
NCBI Official Synonym Symbols
DBC1; DBC-1; NET35; p30DBC; p30 DBC; KIAA1967
NCBI Protein Information
cell cycle and apoptosis regulator protein 2
UniProt Protein Name
Cell cycle and apoptosis regulator protein 2
UniProt Gene Name
CCAR2
UniProt Synonym Gene Names
DBC1; KIAA1967; DBC-1; DBC.1
UniProt Entry Name
CCAR2_HUMAN

Uniprot Description

DBC-1: Core component of the DBIRD complex, a multiprotein complex that acts at the interface between core mRNP particles and RNA polymerase II (RNAPII) and integrates transcript elongation with the regulation of alternative splicing: the DBIRD complex affects local transcript elongation rates and alternative splicing of a large set of exons embedded in (A + T)-rich DNA regions. Inhibits SIRT1 deacetylase activity leading to increasing levels of p53/TP53 acetylation and p53-mediated apoptosis. Inhibits SUV39H1 methyltransferase activity. Component of the DBIRD complex. Interacts with ZNF326/ZIRD; the interaction is direct. Interacts (via N-terminus) with SIRT1. Interacts (via N-terminus) with SUV39H1; this interaction abolishes the interaction with SIRT1. Expressed ubiquitously in normal tissues. Expressed in 84 to 100% of neoplastic breast, lung, and colon tissues. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; RNA-binding; Nuclear receptor co-regulator; Mitochondrial; Apoptosis

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: cytoplasm; mitochondrial matrix; nuclear chromatin; nucleoplasm; nucleus; spliceosome

Molecular Function: enzyme binding; enzyme inhibitor activity; protein binding

Biological Process: mitochondrial fragmentation during apoptosis; negative regulation of catalytic activity; negative regulation of cell growth; negative regulation of proteasomal ubiquitin-dependent protein catabolic process; negative regulation of transcription, DNA-dependent; positive regulation of apoptosis; regulation of circadian rhythm; regulation of protein stability; regulation of RNA elongation; response to UV; RNA splicing

Research Articles on KIAA1967

Similar Products

Product Notes

The KIAA1967 ccar2 (Catalog #AAA1276660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctactga gccttcctga aaaggtcgtg tccccacctg aacctgagaa ggaggaggcg gccaaggaag aagccaccaa ggaggaagaa gccatcaaag aggaggtggt caaggagccc aaggatgagg cacagaatga gggcccggct acagagtcag aggccccgct gaaggaggat gggcttttgc ccaaaccact ctcttctggg ggagaggaag aagaaaaacc ccggggcgag gcttctgagg acctgtgtga gatggccctg gacccagaac tgttgcttct gagggatgat ggagaggagg agtttgcagg agcaaagctg gaggattcgg aggtccggtc cgttgcctca aaccagtcag agatggagtt ctcttcactt caggacatgc ccaaggagct ggatccctct gctgtgctcc ccttagactg tctgcttgct tttgtgttct ttgatgccaa ctggtgtggc tacttgcacc ggcgagactt agagaggatc ctccttaccc ttgggatccg gctcagtgca gagcaggcca agcagctggt cagcagggtg gtgacccaga acatctgcca gtaccggagc cttcagtaca gccgccagga gggcctggat ggtggccttc ccgaggaggt gctcttcgga aacctggacc tgctgccccc tcctgggaaa agcacgaagc caggtgctgc ccccacagaa cacaaagcct tggtgtccca caatggcagc ctgattaacg tggggagcct gctgcagcgc gcggagcagc aggacagcgg ccggctctac ctagagaaca agatccacac actggagctg aagctggagg agagccataa ccgtttctca gccactgaag taaccaataa gacgctggcg gcagagatgc aggagctgcg agtccggctg gcggaggccg aggagaccgc ccggacggcg gagcgacaga agagccagct ccagcggctg ctgcaggagc tccgcaggcg tctgaccccc ctgcagctgg agatccagcg ggtggtggaa aaggctgaca gctgggtgga gaaggaggag ccggcaccta gcaactga. It is sometimes possible for the material contained within the vial of "KIAA1967, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.