Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2U cdna clone

UBE2U cDNA Clone

Synonyms
UBE2U; UBE2U cDNA Clone; UBE2U cdna clone
Ordering
For Research Use Only!
Sequence
atgcacggcagagcttacctcttgctgcacagagacttctgtgatctcaaggagaacaattataagggtatcactgctaagcctgtaagtgaagatatgatggaatgggaagttgaaattgaaggtctacagaattcagtttggcagggtttagtcttccaactgacaatacattttacatcggagtacaactatgctcctccagttgtgaaatttataacaattccgtttcatccaaatgtagacccacacactggtcagccctgtatagactttttggacaaccctgagaagtggaatacaaactatacattgagcagcatcttacttgccctacaggttatgctttctaatccagtgctagagaatccagtgaatttggaagcagccagaatactggttaaagatgaatctctgtacagaacaattctaagacttttcaacaggccattacaaatgaaagatgacagccaggagttacctaaagacccacgtaaatgtatcagaccaattaaaacaacctcatttagtgattactaccagacatggtccagaatagctacatcaaaagccacagaatactacagaactccattgctcaaagttccaaatttcattggacagtattacaaatggaagaaaatggatctacagcatcagaaagaatggaatttaaaatga
Sequence Length
681
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,689 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2U (putative), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 U (putative)
NCBI Official Symbol
UBE2U
NCBI Protein Information
ubiquitin-conjugating enzyme E2 U
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 U
UniProt Gene Name
UBE2U
UniProt Entry Name
UBE2U_HUMAN

Uniprot Description

UBE2U: Catalyzes the covalent attachment of ubiquitin to other proteins. Belongs to the ubiquitin-conjugating enzyme family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: cytoplasm; nuclear chromatin

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: DNA repair; histone ubiquitination; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination

Similar Products

Product Notes

The UBE2U ube2u (Catalog #AAA1276622) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacggca gagcttacct cttgctgcac agagacttct gtgatctcaa ggagaacaat tataagggta tcactgctaa gcctgtaagt gaagatatga tggaatggga agttgaaatt gaaggtctac agaattcagt ttggcagggt ttagtcttcc aactgacaat acattttaca tcggagtaca actatgctcc tccagttgtg aaatttataa caattccgtt tcatccaaat gtagacccac acactggtca gccctgtata gactttttgg acaaccctga gaagtggaat acaaactata cattgagcag catcttactt gccctacagg ttatgctttc taatccagtg ctagagaatc cagtgaattt ggaagcagcc agaatactgg ttaaagatga atctctgtac agaacaattc taagactttt caacaggcca ttacaaatga aagatgacag ccaggagtta cctaaagacc cacgtaaatg tatcagacca attaaaacaa cctcatttag tgattactac cagacatggt ccagaatagc tacatcaaaa gccacagaat actacagaac tccattgctc aaagttccaa atttcattgg acagtattac aaatggaaga aaatggatct acagcatcag aaagaatgga atttaaaatg a. It is sometimes possible for the material contained within the vial of "UBE2U, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.