Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP16 cdna clone

USP16 cDNA Clone

Gene Names
USP16; UBPM; UBP-M
Synonyms
USP16; USP16 cDNA Clone; USP16 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaagaaacggacaaagggaaaaactgttccaatcgatgattcctctgaaactttagaacctgtgtgcagacacattagaaaaggattggaacaaggtaatttgaaaaaggctttagtgaatgtggaatggaatatctgccaagactgtaagactgacaataaagtgaaagataaagctgaagaagaaacagaagaaaagccttcagtttggctgtgtcttaaatgtggccatcagggctgtggcagaaattctcaggagcagcatgccttgaagcactatctgacgccaagatctgaacctcactgtctggttcttagtttggacaactggagtgtatggtgttacgtatgtgataatgaggtccagtattgtagttcaaaccagttgggtcaagtggttgattatgtcagaaaacatgccagcattacaactccaaagccagagaaagataatggaaatattgaacttgaaaataaaaaattagaaaaagagagtaagaatgaacaagagagagaaaagaaggaaaacatggctaaagagaatcctcccatgaattctccttgccaaataaccgtgaaaggactcagtaatttgggaaacacatgtttcttcaatgcagttatgcagaacttgtcacaaacaccagtgcttagagaactactaaaagaagtgaaaatgtctggaacaattgtaaaaattgaaccacctgatttggcattaacagaaccattagaaataaaccttgagcctccaggccctcttactttagccatgagccagtttcttaatgagatgcaagagaccaaaaagggggttgtgacaccgaaagaactcttttctcaggtctgtaaaaaagcagtgcggtttaaaggctatcagcagcaagacagccaggagctgcttcgctacttattggatgggatgagagcagaagaacaccaaagagtgagtaaaggaatacttaaagcatttggtaattctactgaaaagttggatgaagaactaaaaaataaagttaaagattatgagaagaaaaaatcaatgccaagttttgttgaccgcatctttggtggtgaactaactagtatgatcatgtgtgatcaatgcagaactgtctccttggttcatgaatctttccttgatttgtccctcccagttttagatgatcagagtggtaagaaaagtgtaaatgataaaaatctgaaaaagacagtggaggatgaagatcaagatagtgaggaagaaaaagataacgacagttacataaaagagagaagtgatattccttctggaacaagtaagcacttacagaaaaaagcaaagaaacaagccaaaaagcaagccaagaaccaacgaagacaacaaaaaattcaaggaaaagttcttcatttaaatgatatttgtactattgaccatcctgaagacagtgataatgaagctgaaatgtcacttcaaggagaagtaaatattaaatccaaccatatttcacaagagggtgttatgcataaagaatattgtgtcaaccagaaagatttgaatggccaagcaaaaatgatcgaaagtgtaactgacaatcaaaaatccacagaggaagtagatatgaaaaatatcaacatggataatgatctggaggttttaacatcttctcccactaggaatttaaatggtgcctacctaacggaagggagcaatggagaagtggacatttccaatggtttcaaaaacctaaatttgaatgctgctcttcatcctgatgaaataaatatagagattctgaatgatagtcatactcctggaacaaaggtgtatgaggttgtaaatgaagatccagaaactgctttctgtactcttgcaaacagggaagttttcaatactgatgagtgttcaatccaacattgtttatatcagttcacccgtaatgagaaacttcgagatgcgaataaactgctttgtgaagtatgcacacggagacagtgtaatggaccaaaggcaaatataaaaggtgaaaggaagcatgtttacaccaatgccaaaaagcagatgctaatttctcttgctcctcctgttcttactcttcatttaaagagatttcagcaggctggttttaacctacgcaaagttaacaaacacataaagtttccggaaatcttagatttggctcctttttgcacccttaaatgtaagaatgttgcagaagaaaatacaagggtactctattccttatatggagttgttgaacacagtggtactatgaggtcggggcattacactgcctatgccaaggcaagaaccgcaaatagtcatctctctaatcttgttcttcacggtgatattccacaagattttgaaatggaatcaaaagggcagtggtttcacatcagcgacacacatgtgcaagctgtgcctacaactaaagtactaaactcacaagcgtacctcctattttatgagagaatactgtaa
Sequence Length
2469
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,599 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 16, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 16
NCBI Official Symbol
USP16
NCBI Official Synonym Symbols
UBPM; UBP-M
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 16
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 16
UniProt Gene Name
USP16
UniProt Entry Name
UBP16_HUMAN

NCBI Description

This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

USP16: a ubiquitous ubiquitin-processing protease that may de-ubiquitinate one or more critical proteins that are involved in the condensation of mitotic chromosomes, possibly acting selectively on histones H2A and H2B, the major ubiquitinated proteins of chromatin. Is phosphorylated at the onset of mitosis and dephosphorylated during the metaphase/anaphase transition.

Protein type: Ubiquitin-specific protease; EC 3.4.19.12; Protease; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 21q22.11

Cellular Component: cytoplasm; nucleus

Molecular Function: cysteine-type endopeptidase activity; histone binding; transcription coactivator activity; ubiquitin binding; ubiquitin-specific protease activity; zinc ion binding

Biological Process: cell cycle; histone deubiquitination; mitosis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; positive regulation of translational elongation; protein homotetramerization; regulation of transcription from RNA polymerase II promoter; response to DNA damage stimulus

Research Articles on USP16

Similar Products

Product Notes

The USP16 usp16 (Catalog #AAA1276604) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaaga aacggacaaa gggaaaaact gttccaatcg atgattcctc tgaaacttta gaacctgtgt gcagacacat tagaaaagga ttggaacaag gtaatttgaa aaaggcttta gtgaatgtgg aatggaatat ctgccaagac tgtaagactg acaataaagt gaaagataaa gctgaagaag aaacagaaga aaagccttca gtttggctgt gtcttaaatg tggccatcag ggctgtggca gaaattctca ggagcagcat gccttgaagc actatctgac gccaagatct gaacctcact gtctggttct tagtttggac aactggagtg tatggtgtta cgtatgtgat aatgaggtcc agtattgtag ttcaaaccag ttgggtcaag tggttgatta tgtcagaaaa catgccagca ttacaactcc aaagccagag aaagataatg gaaatattga acttgaaaat aaaaaattag aaaaagagag taagaatgaa caagagagag aaaagaagga aaacatggct aaagagaatc ctcccatgaa ttctccttgc caaataaccg tgaaaggact cagtaatttg ggaaacacat gtttcttcaa tgcagttatg cagaacttgt cacaaacacc agtgcttaga gaactactaa aagaagtgaa aatgtctgga acaattgtaa aaattgaacc acctgatttg gcattaacag aaccattaga aataaacctt gagcctccag gccctcttac tttagccatg agccagtttc ttaatgagat gcaagagacc aaaaaggggg ttgtgacacc gaaagaactc ttttctcagg tctgtaaaaa agcagtgcgg tttaaaggct atcagcagca agacagccag gagctgcttc gctacttatt ggatgggatg agagcagaag aacaccaaag agtgagtaaa ggaatactta aagcatttgg taattctact gaaaagttgg atgaagaact aaaaaataaa gttaaagatt atgagaagaa aaaatcaatg ccaagttttg ttgaccgcat ctttggtggt gaactaacta gtatgatcat gtgtgatcaa tgcagaactg tctccttggt tcatgaatct ttccttgatt tgtccctccc agttttagat gatcagagtg gtaagaaaag tgtaaatgat aaaaatctga aaaagacagt ggaggatgaa gatcaagata gtgaggaaga aaaagataac gacagttaca taaaagagag aagtgatatt ccttctggaa caagtaagca cttacagaaa aaagcaaaga aacaagccaa aaagcaagcc aagaaccaac gaagacaaca aaaaattcaa ggaaaagttc ttcatttaaa tgatatttgt actattgacc atcctgaaga cagtgataat gaagctgaaa tgtcacttca aggagaagta aatattaaat ccaaccatat ttcacaagag ggtgttatgc ataaagaata ttgtgtcaac cagaaagatt tgaatggcca agcaaaaatg atcgaaagtg taactgacaa tcaaaaatcc acagaggaag tagatatgaa aaatatcaac atggataatg atctggaggt tttaacatct tctcccacta ggaatttaaa tggtgcctac ctaacggaag ggagcaatgg agaagtggac atttccaatg gtttcaaaaa cctaaatttg aatgctgctc ttcatcctga tgaaataaat atagagattc tgaatgatag tcatactcct ggaacaaagg tgtatgaggt tgtaaatgaa gatccagaaa ctgctttctg tactcttgca aacagggaag ttttcaatac tgatgagtgt tcaatccaac attgtttata tcagttcacc cgtaatgaga aacttcgaga tgcgaataaa ctgctttgtg aagtatgcac acggagacag tgtaatggac caaaggcaaa tataaaaggt gaaaggaagc atgtttacac caatgccaaa aagcagatgc taatttctct tgctcctcct gttcttactc ttcatttaaa gagatttcag caggctggtt ttaacctacg caaagttaac aaacacataa agtttccgga aatcttagat ttggctcctt tttgcaccct taaatgtaag aatgttgcag aagaaaatac aagggtactc tattccttat atggagttgt tgaacacagt ggtactatga ggtcggggca ttacactgcc tatgccaagg caagaaccgc aaatagtcat ctctctaatc ttgttcttca cggtgatatt ccacaagatt ttgaaatgga atcaaaaggg cagtggtttc acatcagcga cacacatgtg caagctgtgc ctacaactaa agtactaaac tcacaagcgt acctcctatt ttatgagaga atactgtaa. It is sometimes possible for the material contained within the vial of "USP16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.