Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC3HC1 cdna clone

ZC3HC1 cDNA Clone

Gene Names
ZC3HC1; NIPA; HSPC216
Synonyms
ZC3HC1; ZC3HC1 cDNA Clone; ZC3HC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgacctggatgcatcctttggcctgaccagctccccaatcccaggccttgaggggcgaccagagcgcttacctctggtgcctgaatctcctcggaggatgatgacccggagccaggatgccactttctccccaggctcagagcaggctgaaaagagccctggtcccattgtctctcgaactcggagctgggactcttccagtcctgttgaccgtcctgagccagaggctgctagccccaccaccagaactcgcccagtgacccgaagcatgggaacaggagacacccctggcctggaggtaccatctagccctctgcggaaagccaagcgagctcgcctctgctcctccagcagttcggacacatcttcccgaagcttctttgatcccacctctcagcatagagactggtgcccttgggtgaatatcacacttggcaaagaaagcagggagaatggtggaactgaaccagatgccagcgccccagcagagccaggctggaaagcagtgctgaccatcctcttggcgcacaaacagtctagccagccagctgaaacggactccatgagtctctctgagaaatcaaggaaagtattccgaatatttcggcagtgggaatctctgtgctcatgctga
Sequence Length
639
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,771 Da
NCBI Official Full Name
Homo sapiens zinc finger, C3HC-type containing 1, mRNA
NCBI Official Synonym Full Names
zinc finger C3HC-type containing 1
NCBI Official Symbol
ZC3HC1
NCBI Official Synonym Symbols
NIPA; HSPC216
NCBI Protein Information
nuclear-interacting partner of ALK
UniProt Protein Name
Nuclear-interacting partner of ALK
Protein Family
UniProt Gene Name
ZC3HC1
UniProt Synonym Gene Names
NIPA; hNIPA
UniProt Entry Name
NIPA_HUMAN

NCBI Description

This gene encodes an F-box-containing protein that is a component of an SCF-type E3 ubiquitin ligase complex that regulates the onset of cell division. The G2/M transition in the cell cycle requires the interaction of the proteins cyclin B1 and cyclin-dependent kinase 1. The activated ubiquitin ligase complex targets the protein cyclin B1 for degradation, preventing this transition to mitosis. [provided by RefSeq, Aug 2013]

Uniprot Description

NIPA: a nuclear protein that interacts with anaplastic lymphoma kinase (ALK). An essential component of an SCF-type E3 ligase complex, SCF(NIPA), a complex that controls mitotic entry by mediating ubiquitination and subsequent degradation of cyclin B1. Its cell-cycle-dependent phosphorylation regulates the assembly of the SCF(NIPA) complex, restricting cyclin B1 ubiquitination activity to interphase. Its inactivation results in nuclear accumulation of cyclin B1 in interphase and premature mitotic entry. May have an antiapoptotic role in NPM-ALK-mediated signaling events. Interacts with the NPM-ALK fusion protein in a tyrosine phosphorylation-dependent manner. Three splice-variant isoforms have been described.

Protein type: Cell cycle regulation; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 7q32.2

Cellular Component: nuclear membrane; nucleus

Molecular Function: protein binding; protein kinase binding

Research Articles on ZC3HC1

Similar Products

Product Notes

The ZC3HC1 zc3hc1 (Catalog #AAA1276595) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgacc tggatgcatc ctttggcctg accagctccc caatcccagg ccttgagggg cgaccagagc gcttacctct ggtgcctgaa tctcctcgga ggatgatgac ccggagccag gatgccactt tctccccagg ctcagagcag gctgaaaaga gccctggtcc cattgtctct cgaactcgga gctgggactc ttccagtcct gttgaccgtc ctgagccaga ggctgctagc cccaccacca gaactcgccc agtgacccga agcatgggaa caggagacac ccctggcctg gaggtaccat ctagccctct gcggaaagcc aagcgagctc gcctctgctc ctccagcagt tcggacacat cttcccgaag cttctttgat cccacctctc agcatagaga ctggtgccct tgggtgaata tcacacttgg caaagaaagc agggagaatg gtggaactga accagatgcc agcgccccag cagagccagg ctggaaagca gtgctgacca tcctcttggc gcacaaacag tctagccagc cagctgaaac ggactccatg agtctctctg agaaatcaag gaaagtattc cgaatatttc ggcagtggga atctctgtgc tcatgctga. It is sometimes possible for the material contained within the vial of "ZC3HC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.