Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX51 cdna clone

DDX51 cDNA Clone

Synonyms
DDX51; DDX51 cDNA Clone; DDX51 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgttctacgtcgcgcggtacccgggccccgatgcggcagctgcggcggggccggagggcgcggaggccggggcgcacggcagggcccgcgcgctgctcgagcggctgcagagccaggcccgcgaacggcagcagcagcgggagcccgcgcagaccgaggcggctgcatcgaccgagccggcgaccaggaggcgacggcggccccggcggcggcggcgggtgaacgacgcggagccggggagcccggaggcgccgcagggaaagcgacggaaggcggacggcgaggacgcgggcgcagaaagcaacgaggaggcgccaggggagcccagcgcagggagcagcgaggaggcgcaaggggggcccagcgcagggagcagcgaggaggcgccgggggtgcgcagcaccagcgccagcgccgaggcggccccagatggaccggccctggaggaggcggccggacccctggtccccggcctggtgctgggggggttcgggaagaggaaggcgccgaaggtcaagcctttcctgccaaggtggctggctgagcctaactgtgtcagaaggaatgtcaccgaagacctggttcctatcgaggacatccctgacgtccatcctgacctgcagaagcagctgcgggcacacggcatctcgtcctactttccagtccaggcagctgtgattcctgccctcctggagagcgcagcctgtgggtttctggtgggcagaggtggctaccggcttagcgacctctgtgtttctgccccaacaggcagtgggaagacactggccttcgtcatccctgtggtgcaggccctgctttcgagagtggtctgccacatccgtgccctggttgtgctgcccaccaaggagctggcccggcaggtgagcaaagttttcaacatctacacagatgccacacctctgagagtctccctggttacgggacagaagtctctggccaaggagcaggagagcctcgtccagaaaacagctgatgggtaccgctgcttggctgacatcgtggtagccacccccggccgcctggtggaccacatcgaccagaccccaggattcagcctccagcagctccgcttcctgattatcgacgaggctgaccggatgattgacagcatgcatcagtcctggctgccgcgggtggtggcggccgccttccagagcgaggaccccgcggacccctgtgccctgctcaagcgaaggcaggcccaggctgtgacagccgccagcacctgctgtccccagatgcccctgcagaagctgctcttctcagctactctgacccagaaccctgaaaagctgcagcagctgggcctccaccagccccggcttttctccacagggctagcacacaggggcctggaagatacagatggggacggggattcggggaagtatgcctttcctgttgggctcacgcaccactacgtgccctgcagcctcagctctaagccgctggtcgtcctgcacctggtcctggagatgggcttctcgagggttctctgcttcactaactcccgagagaactcccacaggctcttcctgctggtgcaagcttttgggggtgtggacgtggctgagttctcctcgcgctacgggcctggccagaggaggatgatcctgaagcagtttgaacaggggaagatccagctgctcatcagcacggacgccaccgcgcgaggcatcgacgtgcagggtgtggagctggtggtgaactacgacgccccccagtacctgagaacctacgtgcaccgggttgggaggacagctcgcgctgggaaaactggacaggccttcacactgctcctgaaagtgcaggagaggagattcctccgaatgctaactgaagctggggcacctgagttgcagcggcacgagctctccagcaagctgctgcagccgctggttcctcggtacgaggaggccctgtccaagctggaggagtctgtcaaggaagagcgcaagcagagggcggcctag
Sequence Length
2001
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,457 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 51, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 51
NCBI Official Symbol
DDX51
NCBI Protein Information
ATP-dependent RNA helicase DDX51
UniProt Protein Name
ATP-dependent RNA helicase DDX51
UniProt Gene Name
DDX51
UniProt Entry Name
DDX51_HUMAN

Uniprot Description

DDX51: ATP-binding RNA helicase involved in the biogenesis of 60S ribosomal subunits. Belongs to the DEAD box helicase family. DDX51/DBP6 subfamily.

Protein type: Hydrolase; Nucleolus; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 12q24.33

Cellular Component: membrane

Molecular Function: ATP-dependent RNA helicase activity

Biological Process: RNA secondary structure unwinding

Similar Products

Product Notes

The DDX51 ddx51 (Catalog #AAA1276570) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgt tctacgtcgc gcggtacccg ggccccgatg cggcagctgc ggcggggccg gagggcgcgg aggccggggc gcacggcagg gcccgcgcgc tgctcgagcg gctgcagagc caggcccgcg aacggcagca gcagcgggag cccgcgcaga ccgaggcggc tgcatcgacc gagccggcga ccaggaggcg acggcggccc cggcggcggc ggcgggtgaa cgacgcggag ccggggagcc cggaggcgcc gcagggaaag cgacggaagg cggacggcga ggacgcgggc gcagaaagca acgaggaggc gccaggggag cccagcgcag ggagcagcga ggaggcgcaa ggggggccca gcgcagggag cagcgaggag gcgccggggg tgcgcagcac cagcgccagc gccgaggcgg ccccagatgg accggccctg gaggaggcgg ccggacccct ggtccccggc ctggtgctgg gggggttcgg gaagaggaag gcgccgaagg tcaagccttt cctgccaagg tggctggctg agcctaactg tgtcagaagg aatgtcaccg aagacctggt tcctatcgag gacatccctg acgtccatcc tgacctgcag aagcagctgc gggcacacgg catctcgtcc tactttccag tccaggcagc tgtgattcct gccctcctgg agagcgcagc ctgtgggttt ctggtgggca gaggtggcta ccggcttagc gacctctgtg tttctgcccc aacaggcagt gggaagacac tggccttcgt catccctgtg gtgcaggccc tgctttcgag agtggtctgc cacatccgtg ccctggttgt gctgcccacc aaggagctgg cccggcaggt gagcaaagtt ttcaacatct acacagatgc cacacctctg agagtctccc tggttacggg acagaagtct ctggccaagg agcaggagag cctcgtccag aaaacagctg atgggtaccg ctgcttggct gacatcgtgg tagccacccc cggccgcctg gtggaccaca tcgaccagac cccaggattc agcctccagc agctccgctt cctgattatc gacgaggctg accggatgat tgacagcatg catcagtcct ggctgccgcg ggtggtggcg gccgccttcc agagcgagga ccccgcggac ccctgtgccc tgctcaagcg aaggcaggcc caggctgtga cagccgccag cacctgctgt ccccagatgc ccctgcagaa gctgctcttc tcagctactc tgacccagaa ccctgaaaag ctgcagcagc tgggcctcca ccagccccgg cttttctcca cagggctagc acacaggggc ctggaagata cagatgggga cggggattcg gggaagtatg cctttcctgt tgggctcacg caccactacg tgccctgcag cctcagctct aagccgctgg tcgtcctgca cctggtcctg gagatgggct tctcgagggt tctctgcttc actaactccc gagagaactc ccacaggctc ttcctgctgg tgcaagcttt tgggggtgtg gacgtggctg agttctcctc gcgctacggg cctggccaga ggaggatgat cctgaagcag tttgaacagg ggaagatcca gctgctcatc agcacggacg ccaccgcgcg aggcatcgac gtgcagggtg tggagctggt ggtgaactac gacgcccccc agtacctgag aacctacgtg caccgggttg ggaggacagc tcgcgctggg aaaactggac aggccttcac actgctcctg aaagtgcagg agaggagatt cctccgaatg ctaactgaag ctggggcacc tgagttgcag cggcacgagc tctccagcaa gctgctgcag ccgctggttc ctcggtacga ggaggccctg tccaagctgg aggagtctgt caaggaagag cgcaagcaga gggcggccta g. It is sometimes possible for the material contained within the vial of "DDX51, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.