Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GDAP1L1 cdna clone

GDAP1L1 cDNA Clone

Gene Names
GDAP1L1; dJ881L22.1; dJ995J12.1.1
Synonyms
GDAP1L1; GDAP1L1 cDNA Clone; GDAP1L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacccccaacaatctgacccccaccaactgcagctggtggcccatctccgcgctggagagcgatgcggccaagccagcggaggcccccgacgctcccgaggcggccagccccgcccattggcccagggagagcctggttctgtaccactggacccagtccttcagctcgcagaaggtgcggctggtgatcgccgagaagggcctggtgtgcgaggagcgggacgtgagcctgccacagagcgagcacaaggagccctggttcatgcggctcaacctgggcgaggaggtgcccgtcatcatccaccgcgacaacatcatcagtgactatgaccagatcattgactatgtggagcgcaccttcacaggagagcacgtggtggccctgatgcccgaggtgggcagcctgcagcacgcacgggtgctgcagtaccgggagctgctggacgcactgcccatggatgcctacacgcatggctgcatcctgcatcccgagctcaccaccgactccatgatccccaagtacgccacggccgagatccgcagacatttagccaatgccaccacggacctcatgaaactggaccatgaagaggagccccagctctccgagccctacctttctaaacaaaagaagctcatggccaagatcttggagcatgatgatgtgagctacctgaagaagatcctcggggaactggccatggtgctggaccagattgaggcggagctggagaagaggaagctggagaacgaggggcagaaatgcgagctgtggctctgtggctgtgccttcaccctcgctgatgtcctcctgggagccaccctgcaccgcctcaagttcctgggactgtccaagaaatactgggaagatggcagccggcccaacctgcagtccttctttgagagggtccagagacgctttgccttccggaaagtcctgggtgacatccacaccaccctgctgtcggccgtcatccccaatgctttccggctggtcaagaggaaacccccatccttcttcggggcgtccttcctcatgggctccctgggtgggatgggctactttgcctactggtacctcaagaaaaaatacatctag
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,824 Da
NCBI Official Full Name
Homo sapiens ganglioside-induced differentiation-associated protein 1-like 1, mRNA
NCBI Official Synonym Full Names
ganglioside induced differentiation associated protein 1 like 1
NCBI Official Symbol
GDAP1L1
NCBI Official Synonym Symbols
dJ881L22.1; dJ995J12.1.1
NCBI Protein Information
ganglioside-induced differentiation-associated protein 1-like 1
UniProt Protein Name
Ganglioside-induced differentiation-associated protein 1-like 1
UniProt Gene Name
GDAP1L1
UniProt Synonym Gene Names
GDAP1-L1
UniProt Entry Name
GD1L1_HUMAN

NCBI Description

The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]

Uniprot Description

GDAP1L1: The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]

Chromosomal Location of Human Ortholog: 20q12

Cellular Component: cytoplasm

Molecular Function: glutathione transferase activity

Biological Process: glutathione metabolic process

Similar Products

Product Notes

The GDAP1L1 gdap1l1 (Catalog #AAA1276537) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccc ccaacaatct gacccccacc aactgcagct ggtggcccat ctccgcgctg gagagcgatg cggccaagcc agcggaggcc cccgacgctc ccgaggcggc cagccccgcc cattggccca gggagagcct ggttctgtac cactggaccc agtccttcag ctcgcagaag gtgcggctgg tgatcgccga gaagggcctg gtgtgcgagg agcgggacgt gagcctgcca cagagcgagc acaaggagcc ctggttcatg cggctcaacc tgggcgagga ggtgcccgtc atcatccacc gcgacaacat catcagtgac tatgaccaga tcattgacta tgtggagcgc accttcacag gagagcacgt ggtggccctg atgcccgagg tgggcagcct gcagcacgca cgggtgctgc agtaccggga gctgctggac gcactgccca tggatgccta cacgcatggc tgcatcctgc atcccgagct caccaccgac tccatgatcc ccaagtacgc cacggccgag atccgcagac atttagccaa tgccaccacg gacctcatga aactggacca tgaagaggag ccccagctct ccgagcccta cctttctaaa caaaagaagc tcatggccaa gatcttggag catgatgatg tgagctacct gaagaagatc ctcggggaac tggccatggt gctggaccag attgaggcgg agctggagaa gaggaagctg gagaacgagg ggcagaaatg cgagctgtgg ctctgtggct gtgccttcac cctcgctgat gtcctcctgg gagccaccct gcaccgcctc aagttcctgg gactgtccaa gaaatactgg gaagatggca gccggcccaa cctgcagtcc ttctttgaga gggtccagag acgctttgcc ttccggaaag tcctgggtga catccacacc accctgctgt cggccgtcat ccccaatgct ttccggctgg tcaagaggaa acccccatcc ttcttcgggg cgtccttcct catgggctcc ctgggtggga tgggctactt tgcctactgg tacctcaaga aaaaatacat ctag. It is sometimes possible for the material contained within the vial of "GDAP1L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.