Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPY19L2P1 cdna clone

DPY19L2P1 cDNA Clone

Synonyms
DPY19L2P1; DPY19L2P1 cDNA Clone; DPY19L2P1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaaacaaggagtaaacccaaagccgctgcaatcttcccgccccagcccgtctaagcggccgtacggggcctcccccgcccgggagctggaggtggaaaagtcggccctaggcggcgggaaactgccagggggcgccaggaggtcctccccggggaggatcccaaatctgaaaaagcgaaaaggcttggagctaaaggtggtggccaagacccttctcgaccccttccagttcgtccgtaattccctggcgcagctccgggaagaggtgcacgaactgcaggcgcggtggttccccagcagaaccactctcagcatcgccatctttgtggcaattctacattggttacatttagtaacactttttgaaaatgatcgtcatttctctcacctctcatctttggaatgggagatgacttttcgcactaaaatgggactttattattcctacttcaagaccatcattgaagcaccttcatttttggaaggactgtggatgattatgaatgacaggcttactgaatatcctcttgtaattaatacagtaaaacgcttccatctttatccagaggtaatcatagctgcctggtatcgcacattcataggaataatgaatttatttggactagaaactaagacctgctggaatgtcaccagaatagaacctcttaatgagttcaaagctgtgaaggattgggagatcctgcttgcttttatgttggtgtaa
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,036 Da
NCBI Official Full Name
Homo sapiens dpy-19-like 2 pseudogene 1 (C. elegans), mRNA
NCBI Official Synonym Full Names
DPY19L2 pseudogene 1
NCBI Official Symbol
DPY19L2P1
UniProt Protein Name
Putative C-mannosyltransferase DPY19L2P1
UniProt Gene Name
DPY19L2P1
UniProt Entry Name
D19P1_HUMAN

Uniprot Description

DPY19L2P1: Belongs to the dpy-19 family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 7p14.2

Similar Products

Product Notes

The DPY19L2P1 dpy19l2p1 (Catalog #AAA1276525) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaaac aaggagtaaa cccaaagccg ctgcaatctt cccgccccag cccgtctaag cggccgtacg gggcctcccc cgcccgggag ctggaggtgg aaaagtcggc cctaggcggc gggaaactgc cagggggcgc caggaggtcc tccccgggga ggatcccaaa tctgaaaaag cgaaaaggct tggagctaaa ggtggtggcc aagacccttc tcgacccctt ccagttcgtc cgtaattccc tggcgcagct ccgggaagag gtgcacgaac tgcaggcgcg gtggttcccc agcagaacca ctctcagcat cgccatcttt gtggcaattc tacattggtt acatttagta acactttttg aaaatgatcg tcatttctct cacctctcat ctttggaatg ggagatgact tttcgcacta aaatgggact ttattattcc tacttcaaga ccatcattga agcaccttca tttttggaag gactgtggat gattatgaat gacaggctta ctgaatatcc tcttgtaatt aatacagtaa aacgcttcca tctttatcca gaggtaatca tagctgcctg gtatcgcaca ttcataggaa taatgaattt atttggacta gaaactaaga cctgctggaa tgtcaccaga atagaacctc ttaatgagtt caaagctgtg aaggattggg agatcctgct tgcttttatg ttggtgtaa. It is sometimes possible for the material contained within the vial of "DPY19L2P1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.