CCNJ cdna clone
CCNJ cDNA Clone
Gene Names
CCNJ; bA690P14.1
Synonyms
CCNJ; CCNJ cDNA Clone; CCNJ cdna clone
Sequence
atggagctggaggggcagtggtggcgaggacagctggccgccgatattcaccaagcgcttcgctacaaggagctgaagttgccctcctataaaggccagtcccctcagttaagtctcagacggtattttgctgacttgattgccattgtgagcaatcgcttcacactctgcccttctgcccgccatcttgctgtctatttactggacctgtttatggaccgctatgacatctctatccagcagctgcatttagttgcgctttcctgcctgcttctagcaagtaaatttgaagaaaaagaagacagtgtgcctaagctggagcagctcaacagcctgggttgtatgactaatatgaatctagtattaacaaaacaaaatttgctacatatggaactattattattagaaacctttcagtggaacctctgccttccaacagccgcccatttcattgagtattatctctctgaagcagtacacgaaacagatcttcatgacggctggccaatgatttgcttggaaaagactaaactctacatggccaaatatgcagattacttcctggaagtatctttgcaagtagctgctgcatgtgtggcttcttcgaggattatacttcgtctttctccaacgtggcctacaagactacatcgtcttactgcctactcttgggatttcttagtgcagtgtattgaacgactgttgatcgctcatgataatgatgtgaaagaagcaaacaaacagagagggcaagcaggacctcagtcagcgcaactaagtgtattccagacagcctcccagccatcacggccagttcactttcagcaacctcagtatctccatcagacacatcagacctcactgcagtatcgccatcctacgtcagaacaaccaagctgtcagcagattgtatcgaccacacacacctcatcttacacactacagacatgtcctgctggcttccaaactagtgttcagggccttgggcacatgcagactggtgttgggatgtcactggcaataccagtagaagttaagccctgtctgagtgtttcttacaaccggagttatcagataaatgaacattacccttgtattactccatgttttgaaaggtga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,836 Da
NCBI Official Full Name
Homo sapiens cyclin J, mRNA
NCBI Official Synonym Full Names
cyclin J
NCBI Official Symbol
CCNJ
NCBI Official Synonym Symbols
bA690P14.1
NCBI Protein Information
cyclin-J
UniProt Protein Name
Cyclin-J
Protein Family
UniProt Gene Name
CCNJ
UniProt Entry Name
CCNJ_HUMAN
Uniprot Description
CCNJ: Belongs to the cyclin family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 10q23.33
Research Articles on CCNJ
Similar Products
Product Notes
The CCNJ ccnj (Catalog #AAA1276393) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgg aggggcagtg gtggcgagga cagctggccg ccgatattca ccaagcgctt cgctacaagg agctgaagtt gccctcctat aaaggccagt cccctcagtt aagtctcaga cggtattttg ctgacttgat tgccattgtg agcaatcgct tcacactctg cccttctgcc cgccatcttg ctgtctattt actggacctg tttatggacc gctatgacat ctctatccag cagctgcatt tagttgcgct ttcctgcctg cttctagcaa gtaaatttga agaaaaagaa gacagtgtgc ctaagctgga gcagctcaac agcctgggtt gtatgactaa tatgaatcta gtattaacaa aacaaaattt gctacatatg gaactattat tattagaaac ctttcagtgg aacctctgcc ttccaacagc cgcccatttc attgagtatt atctctctga agcagtacac gaaacagatc ttcatgacgg ctggccaatg atttgcttgg aaaagactaa actctacatg gccaaatatg cagattactt cctggaagta tctttgcaag tagctgctgc atgtgtggct tcttcgagga ttatacttcg tctttctcca acgtggccta caagactaca tcgtcttact gcctactctt gggatttctt agtgcagtgt attgaacgac tgttgatcgc tcatgataat gatgtgaaag aagcaaacaa acagagaggg caagcaggac ctcagtcagc gcaactaagt gtattccaga cagcctccca gccatcacgg ccagttcact ttcagcaacc tcagtatctc catcagacac atcagacctc actgcagtat cgccatccta cgtcagaaca accaagctgt cagcagattg tatcgaccac acacacctca tcttacacac tacagacatg tcctgctggc ttccaaacta gtgttcaggg ccttgggcac atgcagactg gtgttgggat gtcactggca ataccagtag aagttaagcc ctgtctgagt gtttcttaca accggagtta tcagataaat gaacattacc cttgtattac tccatgtttt gaaaggtga. It is sometimes possible for the material contained within the vial of "CCNJ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
