Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SF3A3 cdna clone

SF3A3 cDNA Clone

Gene Names
SF3A3; PRP9; PRPF9; SAP61; SF3a60
Synonyms
SF3A3; SF3A3 cDNA Clone; SF3A3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgagggatttgtatgatgataaggatggattacgaaaggaggagctcaatgccatttcaggacccaatgagtttgctgaattctataatagactcaagcaaataaaggaattccaccggaagcacccaaatgagatctgtgtgccaatgtcagtggaatttgaggaactcctgaaggctcgagagaatccaagtgaagaggcacaaaacttggtggagttcacagatgaagagggatatggtcgttatctcgatctccatgactgttacctcaagtacattaacctgaaggcatctgagaagctggattatatcacatacctgtccatctttgaccaattatttgacattcctaaagaaaggaagaatgcagagtataagagatacctagagatgctgcttgagtaccttcaggattacacagatagagtgaagcctctccaagatcagaatgaactttttgggaagattcaggctgagtttgagaagaaatgggagaatgggacctttcctggatggccgaaagagacaagcagtgccctgacccatgctggagcccatcttgacctctctgcattctcctcctgggaggagttggcttctctgggtttggacagattgaaatctgctctcttagctttaggcttgaaatgtggcgggaccctagaagagcgagcccagagactattcagtaccaaaggaaagtccctggagtcacttgatacctctttgtttgccaaaaatcccaagtcaaagggcaccaagcgagacactgaaaggaacaaagacattgcttttctagaagcccagatctatgaatatgtagagattctcggggaacagcgacatctcactcatgaaaatgtacagcgcaagcaagccaggacaggagaagagcgagaagaagaggaagaagagcagatcagtgagagtgagagtgaagatgaagagaacgagatcatttacaaccccaaaaacctgccacttggctgggatggcaaacctattccctactggctgtataagcttcatggcctaaatatcaactacaactgtgagatttgtggaaactacacctaccgagggcccaaagccttccagcgacactttgctgaatggcgtcatgctcatggcatgaggtgtttgggcatcccaaacactgctcactttgctaatgtgacacagattgaagatgctgtctccttgtgggccaaactgaaattgcagaaggcttcagaacgatggcagcctgacactgaggaagaatatgaagactcaagtgggaatgttgtgaataagaagacatacgaggatctgaaaagacaaggactgctctag
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,849 Da
NCBI Official Full Name
Homo sapiens splicing factor 3a, subunit 3, 60kDa, mRNA
NCBI Official Synonym Full Names
splicing factor 3a subunit 3
NCBI Official Symbol
SF3A3
NCBI Official Synonym Symbols
PRP9; PRPF9; SAP61; SF3a60
NCBI Protein Information
splicing factor 3A subunit 3
UniProt Protein Name
Splicing factor 3A subunit 3
UniProt Gene Name
SF3A3
UniProt Synonym Gene Names
SAP61; SAP 61
UniProt Entry Name
SF3A3_HUMAN

NCBI Description

This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

SF3A3: subunit of the splicing factor SF3A required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence (BPS) in pre-mRNA. Sequence independent binding of SF3A/SF3B complex upstream of the branch site is essential, it may anchor U2 snRNP to the pre-mRNA. May also be involved in the assembly of the 'E' complex.

Protein type: RNA splicing; Spliceosome; Motility/polarity/chemotaxis; RNA-binding

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: nucleoplasm; spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: mRNA processing; nuclear mRNA 3'-splice site recognition; nuclear mRNA splicing, via spliceosome; RNA splicing; RNA splicing, via transesterification reactions

Research Articles on SF3A3

Similar Products

Product Notes

The SF3A3 sf3a3 (Catalog #AAA1276373) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacaa tactggagca gcagcggcgc tatcatgagg agaaggaacg gctcatggac gtcatggcta aagagatgct caccaagaag tccacgctcc gggaccagat caattctgat caccgcactc gggccatgca agataggtat atggaggtca gtgggaacct gagggatttg tatgatgata aggatggatt acgaaaggag gagctcaatg ccatttcagg acccaatgag tttgctgaat tctataatag actcaagcaa ataaaggaat tccaccggaa gcacccaaat gagatctgtg tgccaatgtc agtggaattt gaggaactcc tgaaggctcg agagaatcca agtgaagagg cacaaaactt ggtggagttc acagatgaag agggatatgg tcgttatctc gatctccatg actgttacct caagtacatt aacctgaagg catctgagaa gctggattat atcacatacc tgtccatctt tgaccaatta tttgacattc ctaaagaaag gaagaatgca gagtataaga gatacctaga gatgctgctt gagtaccttc aggattacac agatagagtg aagcctctcc aagatcagaa tgaacttttt gggaagattc aggctgagtt tgagaagaaa tgggagaatg ggacctttcc tggatggccg aaagagacaa gcagtgccct gacccatgct ggagcccatc ttgacctctc tgcattctcc tcctgggagg agttggcttc tctgggtttg gacagattga aatctgctct cttagcttta ggcttgaaat gtggcgggac cctagaagag cgagcccaga gactattcag taccaaagga aagtccctgg agtcacttga tacctctttg tttgccaaaa atcccaagtc aaagggcacc aagcgagaca ctgaaaggaa caaagacatt gcttttctag aagcccagat ctatgaatat gtagagattc tcggggaaca gcgacatctc actcatgaaa atgtacagcg caagcaagcc aggacaggag aagagcgaga agaagaggaa gaagagcaga tcagtgagag tgagagtgaa gatgaagaga acgagatcat ttacaacccc aaaaacctgc cacttggctg ggatggcaaa cctattccct actggctgta taagcttcat ggcctaaata tcaactacaa ctgtgagatt tgtggaaact acacctaccg agggcccaaa gccttccagc gacactttgc tgaatggcgt catgctcatg gcatgaggtg tttgggcatc ccaaacactg ctcactttgc taatgtgaca cagattgaag atgctgtctc cttgtgggcc aaactgaaat tgcagaaggc ttcagaacga tggcagcctg acactgagga agaatatgaa gactcaagtg ggaatgttgt gaataagaag acatacgagg atctgaaaag acaaggactg ctctag. It is sometimes possible for the material contained within the vial of "SF3A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.