CHAC1 cdna clone
CHAC1 cDNA Clone
Synonyms
CHAC1; CHAC1 cDNA Clone; CHAC1 cdna clone
Sequence
atgaagcaggagtctgcagccccgaacaccccgcccacctcgcagtcccctacgccgtccgctcagttcccccgaaacgacggcgaccctcaagcgctgtggattttcgggtacggctccctggtgtggaggcccgacttcgcctacagcgacagccgtgtgggcttcgtgcgcggctacagccgccgtttctggcagggagacaccttccatcggggcagcgacaagatgcctggccgtgtggtgacgctccttgaagatcatgagggctgcacttggggcgtggcataccaagtgcaaggggagcaggtaagcaaggccctgaagtacctgaatgtgcgagaggcagtgcttggtggctacgataccaaggaggtcaccttctatccccaagatgctcctgaccaaccactgaaggcattggcctatgtggccaccccacagaaccctggttacctgggccctgcgcctgaagaggccattgccacgcagatcctggcctgccggggcttctccggccacaaccttgaatacttgctgcgtctggcagacttcatgcagctctgtgggcctcaggcgcaggacgagcacctggcagccatcgtggacgctgtgggcaccatgttgccctgcttctgccccaccgagcaggctctggcgctggtgtga
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,795 Da
NCBI Official Full Name
Homo sapiens ChaC, cation transport regulator homolog 1 (E. coli), mRNA
NCBI Official Synonym Full Names
ChaC glutathione specific gamma-glutamylcyclotransferase 1
NCBI Official Symbol
CHAC1
NCBI Protein Information
glutathione-specific gamma-glutamylcyclotransferase 1
UniProt Protein Name
Glutathione-specific gamma-glutamylcyclotransferase 1
Protein Family
UniProt Gene Name
CHAC1
UniProt Synonym Gene Names
Botch
UniProt Entry Name
CHAC1_HUMAN
Uniprot Description
CHAC1: Negative regulator of Notch signaling pathway involved in embryonic neurogenesis: acts by inhibiting Notch cleavage by furin, maintaining Notch in an immature inactive form, thereby promoting neurogenesis in embryos. May also act as a pro-apoptotic component of the unfolded protein response pathway by mediating the pro-apoptotic effects of the ATF4-ATF3-DDIT3/CHOP cascade. Belongs to the chaC family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 15q15.1
Cellular Component: cytosol; trans-Golgi network
Molecular Function: gamma-glutamylcyclotransferase activity; Notch binding; protein binding
Biological Process: glutathione biosynthetic process; negative regulation of Notch signaling pathway; neurogenesis
Research Articles on CHAC1
Similar Products
Product Notes
The CHAC1 chac1 (Catalog #AAA1276213) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcagg agtctgcagc cccgaacacc ccgcccacct cgcagtcccc tacgccgtcc gctcagttcc cccgaaacga cggcgaccct caagcgctgt ggattttcgg gtacggctcc ctggtgtgga ggcccgactt cgcctacagc gacagccgtg tgggcttcgt gcgcggctac agccgccgtt tctggcaggg agacaccttc catcggggca gcgacaagat gcctggccgt gtggtgacgc tccttgaaga tcatgagggc tgcacttggg gcgtggcata ccaagtgcaa ggggagcagg taagcaaggc cctgaagtac ctgaatgtgc gagaggcagt gcttggtggc tacgatacca aggaggtcac cttctatccc caagatgctc ctgaccaacc actgaaggca ttggcctatg tggccacccc acagaaccct ggttacctgg gccctgcgcc tgaagaggcc attgccacgc agatcctggc ctgccggggc ttctccggcc acaaccttga atacttgctg cgtctggcag acttcatgca gctctgtggg cctcaggcgc aggacgagca cctggcagcc atcgtggacg ctgtgggcac catgttgccc tgcttctgcc ccaccgagca ggctctggcg ctggtgtga. It is sometimes possible for the material contained within the vial of "CHAC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
