Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR4 cdna clone

WDR4 cDNA Clone

Gene Names
WDR4; TRM82; TRMT82
Synonyms
WDR4; WDR4 cDNA Clone; WDR4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggctctgtgggactggcgttgtgcgggcagacgttggtggtgcggggcggcagccgattcctggccacctccatagcaagcagtgatgatgacagcctcttcatctatgactgcagtgctgcagaaaagaagtcacaagaaaataaaggggaggacgcgcccttggaccaggggagcggtgcgattctggcgtccaccttctccaagtctggcagctattttgctttaaccgatgacagtaagcgtctgattcttttccgtacaaaaccatggcaatgtctgagtgtcaggaccgtggcaaggaggtgtacagccctgactttcatagcctcggaggagaaggtcttggtggccgacaagtctggagacgtctactccttttcggtgctggagccacacgggtgtggccgtctagagctgggacacctgtctatgctgttagatgtggctgtgagtcctgatgaccgcttcatcctcactgccgaccgggacgagaagatccgagtcagctgggccgcggcgccccatagcatcgagtccttctgcttggggcacacagagtttgtgagccgtatctccgtggtgccaactcagcccgggctgcttctgtcctcctctggggacggcaccctgaggctctgggagtacaggagcggccgccagctgcactgctgtcacctggccagtctgcaggagctggtggacccccaggccccccagaagtttgccgcgtccaggattgcattctggtgccaggagaactgcgtggcgctcctgtgcgacggcactcctgtggtctacatcttccagctggacgcccgcagacagcagttggtgtacaggcagcagctggcgttccagcaccaagtgtgggacgtggctttcgaggagacccaggggctgtgggtgctccaggactgccaggaagcccccctggtgctctacaggcctgtgggcgaccagtggcagtctgttcctgagagcaccgtgttaaagaaagtctctggtgttcttcgtgggaactgggccatgctggaaggctctgccggcgcagacgccagcttcagcagtctctacaaggccacgttcgacaacgtgacctcctacctgaagaagaaagaggagagactgcagcagcagctagagaagaagcagcggcgccggagtcccccgcctgggcccgacgggcatgccaagaagatgagaccgggggaggcgacgctaagttgctga
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,946 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 4, mRNA
NCBI Official Synonym Full Names
WD repeat domain 4
NCBI Official Symbol
WDR4
NCBI Official Synonym Symbols
TRM82; TRMT82
NCBI Protein Information
tRNA (guanine-N(7)-)-methyltransferase non-catalytic subunit WDR4
UniProt Protein Name
tRNA (guanine-N(7)-)-methyltransferase non-catalytic subunit WDR4
Protein Family
UniProt Gene Name
WDR4
UniProt Entry Name
WDR4_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]

Uniprot Description

WDR4: a WD40 repeat protein. Required for 7-methylguanosine modification of tRNA. Forms a complex with METTL1. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; tRNA (guanine-N7-)-methyltransferase activity

Biological Process: tRNA modification

Research Articles on WDR4

Similar Products

Product Notes

The WDR4 wdr4 (Catalog #AAA1276184) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggct ctgtgggact ggcgttgtgc gggcagacgt tggtggtgcg gggcggcagc cgattcctgg ccacctccat agcaagcagt gatgatgaca gcctcttcat ctatgactgc agtgctgcag aaaagaagtc acaagaaaat aaaggggagg acgcgccctt ggaccagggg agcggtgcga ttctggcgtc caccttctcc aagtctggca gctattttgc tttaaccgat gacagtaagc gtctgattct tttccgtaca aaaccatggc aatgtctgag tgtcaggacc gtggcaagga ggtgtacagc cctgactttc atagcctcgg aggagaaggt cttggtggcc gacaagtctg gagacgtcta ctccttttcg gtgctggagc cacacgggtg tggccgtcta gagctgggac acctgtctat gctgttagat gtggctgtga gtcctgatga ccgcttcatc ctcactgccg accgggacga gaagatccga gtcagctggg ccgcggcgcc ccatagcatc gagtccttct gcttggggca cacagagttt gtgagccgta tctccgtggt gccaactcag cccgggctgc ttctgtcctc ctctggggac ggcaccctga ggctctggga gtacaggagc ggccgccagc tgcactgctg tcacctggcc agtctgcagg agctggtgga cccccaggcc ccccagaagt ttgccgcgtc caggattgca ttctggtgcc aggagaactg cgtggcgctc ctgtgcgacg gcactcctgt ggtctacatc ttccagctgg acgcccgcag acagcagttg gtgtacaggc agcagctggc gttccagcac caagtgtggg acgtggcttt cgaggagacc caggggctgt gggtgctcca ggactgccag gaagcccccc tggtgctcta caggcctgtg ggcgaccagt ggcagtctgt tcctgagagc accgtgttaa agaaagtctc tggtgttctt cgtgggaact gggccatgct ggaaggctct gccggcgcag acgccagctt cagcagtctc tacaaggcca cgttcgacaa cgtgacctcc tacctgaaga agaaagagga gagactgcag cagcagctag agaagaagca gcggcgccgg agtcccccgc ctgggcccga cgggcatgcc aagaagatga gaccggggga ggcgacgcta agttgctga. It is sometimes possible for the material contained within the vial of "WDR4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.